Incidental Mutation 'R6813:Vmn2r96'
ID 533982
Institutional Source Beutler Lab
Gene Symbol Vmn2r96
Ensembl Gene ENSMUSG00000091679
Gene Name vomeronasal 2, receptor 96
Synonyms EG433070
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock # R6813 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 18573151-18616003 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 18581854 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 119 (H119R)
Ref Sequence ENSEMBL: ENSMUSP00000156012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165692] [ENSMUST00000177244] [ENSMUST00000231261] [ENSMUST00000231286]
AlphaFold E9PZU5
Predicted Effect probably benign
Transcript: ENSMUST00000165692
SMART Domains Protein: ENSMUSP00000131564
Gene: ENSMUSG00000091679

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 257 8.6e-20 PFAM
Pfam:NCD3G 317 370 3.7e-22 PFAM
Pfam:7tm_3 402 638 3.9e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177244
AA Change: H119R

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000135095
Gene: ENSMUSG00000091679
AA Change: H119R

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 245 4.2e-19 PFAM
Pfam:NCD3G 317 370 6.9e-21 PFAM
Pfam:7tm_3 400 639 3.4e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231261
Predicted Effect probably benign
Transcript: ENSMUST00000231286
AA Change: H119R

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.9%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,229,282 N2337K probably benign Het
Adgrb2 C A 4: 130,009,491 Q603K probably damaging Het
Adgrf3 A G 5: 30,197,521 F503S probably damaging Het
Arfgap3 A T 15: 83,330,593 M164K probably benign Het
Asb13 G T 13: 3,645,029 V166F probably damaging Het
Atm T G 9: 53,497,235 R1103S probably benign Het
Atxn7l1 T C 12: 33,367,124 I626T probably damaging Het
Brsk2 A G 7: 142,002,477 I649V probably benign Het
Ccdc25 T A 14: 65,856,433 M85K probably benign Het
Cdc42bpb A G 12: 111,327,615 V231A probably damaging Het
Clstn3 T A 6: 124,436,935 M767L probably benign Het
Col6a6 C T 9: 105,783,941 R323K probably benign Het
Creld1 A G 6: 113,489,569 Y199C probably damaging Het
Csf1r T A 18: 61,112,734 D254E probably benign Het
Dab2ip C T 2: 35,730,473 Q1118* probably null Het
Dcun1d4 C A 5: 73,520,957 S98R possibly damaging Het
Disp3 G A 4: 148,259,930 P505L probably benign Het
Dlec1 A T 9: 119,112,102 Q240L probably benign Het
Edil3 T A 13: 89,289,456 I392N probably damaging Het
Epha10 T A 4: 124,902,693 S398R Het
Ephb1 A G 9: 102,010,048 I464T possibly damaging Het
Eps15 T A 4: 109,280,402 probably null Het
Fam111a T A 19: 12,587,342 C152S probably damaging Het
Flt3 T C 5: 147,354,843 E599G probably damaging Het
Frmd3 T C 4: 74,159,245 S259P probably benign Het
Gm15922 T C 7: 3,736,003 H535R probably benign Het
Gm30302 T A 13: 49,787,396 R279S probably benign Het
Hsfy2 A G 1: 56,636,302 Y359H possibly damaging Het
Ifih1 C T 2: 62,645,693 V80M possibly damaging Het
Il12rb2 A C 6: 67,292,374 D818E probably damaging Het
Il4i1 A G 7: 44,839,812 T334A probably benign Het
Irs2 G A 8: 11,004,659 Q1258* probably null Het
Lsm1 T G 8: 25,793,693 H44Q probably benign Het
Mgam A T 6: 40,750,165 M1257L probably damaging Het
Myc T C 15: 61,988,152 S225P probably damaging Het
Myh1 T C 11: 67,220,460 V1575A probably benign Het
Myo9b A G 8: 71,323,305 D380G probably damaging Het
Ncoa7 T A 10: 30,696,192 D157V probably damaging Het
Olfr314 G T 11: 58,786,646 Q137H probably benign Het
Olfr828 G A 9: 18,815,892 T134M probably benign Het
Olfr877 A C 9: 37,855,514 E232A possibly damaging Het
Olfr883 T C 9: 38,025,833 V9A probably damaging Het
Olfr980 T A 9: 40,006,457 H164L probably benign Het
Pccb A G 9: 101,023,215 V117A probably damaging Het
Pdp2 C T 8: 104,594,499 H327Y probably damaging Het
Pdzph1 G T 17: 58,974,436 Q284K probably benign Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Phldb1 A T 9: 44,699,568 S751R probably damaging Het
Ppp1r1b T A 11: 98,349,176 probably null Het
Ppp1r3a A G 6: 14,719,571 V448A probably benign Het
Pvrig A T 5: 138,342,050 T28S probably benign Het
Rasgrf1 G A 9: 90,010,484 probably null Het
Scnn1g T C 7: 121,740,353 L125S probably damaging Het
Slc30a7 A T 3: 115,981,811 D221E probably benign Het
Tmem30c A G 16: 57,281,259 probably null Het
Tmem33 T C 5: 67,264,459 probably null Het
Ttc29 A T 8: 78,333,620 T390S probably benign Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn2r81 T A 10: 79,268,605 F354Y probably benign Het
Wdr3 G A 3: 100,138,725 R931* probably null Het
Wdr78 T C 4: 103,048,326 K753E probably benign Het
Wtap A T 17: 12,967,510 N383K probably damaging Het
Zfp808 T C 13: 62,173,035 Y693H probably damaging Het
Other mutations in Vmn2r96
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Vmn2r96 APN 17 18583815 missense probably benign 0.00
IGL00563:Vmn2r96 APN 17 18583815 missense probably benign 0.00
IGL00769:Vmn2r96 APN 17 18583819 missense probably benign 0.00
IGL01314:Vmn2r96 APN 17 18582964 missense probably benign 0.00
IGL01983:Vmn2r96 APN 17 18597265 missense probably damaging 0.99
IGL02314:Vmn2r96 APN 17 18583959 missense probably benign 0.01
IGL02600:Vmn2r96 APN 17 18597567 missense probably benign
IGL02672:Vmn2r96 APN 17 18598114 missense probably benign 0.02
IGL02750:Vmn2r96 APN 17 18582589 missense probably benign 0.01
IGL03068:Vmn2r96 APN 17 18582875 missense probably benign 0.00
IGL03411:Vmn2r96 APN 17 18586372 missense possibly damaging 0.88
R0316:Vmn2r96 UTSW 17 18582565 missense probably damaging 1.00
R0502:Vmn2r96 UTSW 17 18584000 missense probably benign
R0580:Vmn2r96 UTSW 17 18582638 missense probably damaging 1.00
R0652:Vmn2r96 UTSW 17 18597568 missense probably benign 0.05
R0789:Vmn2r96 UTSW 17 18582476 missense possibly damaging 0.81
R1462:Vmn2r96 UTSW 17 18597398 missense possibly damaging 0.94
R1462:Vmn2r96 UTSW 17 18597398 missense possibly damaging 0.94
R1660:Vmn2r96 UTSW 17 18597726 missense probably benign 0.00
R1755:Vmn2r96 UTSW 17 18582653 missense possibly damaging 0.50
R1843:Vmn2r96 UTSW 17 18597921 missense probably benign 0.14
R1943:Vmn2r96 UTSW 17 18586402 missense probably benign 0.09
R1993:Vmn2r96 UTSW 17 18583876 missense probably damaging 1.00
R2018:Vmn2r96 UTSW 17 18584001 missense probably benign
R2405:Vmn2r96 UTSW 17 18597840 missense probably damaging 0.96
R3977:Vmn2r96 UTSW 17 18597679 missense probably damaging 1.00
R3979:Vmn2r96 UTSW 17 18597679 missense probably damaging 1.00
R4059:Vmn2r96 UTSW 17 18598077 missense probably benign 0.20
R4693:Vmn2r96 UTSW 17 18583008 missense probably benign 0.03
R4709:Vmn2r96 UTSW 17 18582826 missense probably benign 0.36
R4776:Vmn2r96 UTSW 17 18597508 missense probably damaging 1.00
R4882:Vmn2r96 UTSW 17 18597604 missense probably damaging 1.00
R4920:Vmn2r96 UTSW 17 18582656 missense probably benign 0.07
R5143:Vmn2r96 UTSW 17 18583858 missense possibly damaging 0.65
R5301:Vmn2r96 UTSW 17 18597688 missense probably damaging 0.98
R5507:Vmn2r96 UTSW 17 18597829 missense probably damaging 1.00
R6151:Vmn2r96 UTSW 17 18583959 missense probably benign 0.01
R6181:Vmn2r96 UTSW 17 18583864 missense probably benign
R6339:Vmn2r96 UTSW 17 18583862 missense possibly damaging 0.84
R6404:Vmn2r96 UTSW 17 18597531 missense probably damaging 1.00
R6452:Vmn2r96 UTSW 17 18583855 missense probably benign 0.07
R6749:Vmn2r96 UTSW 17 18598090 missense probably damaging 0.99
R6851:Vmn2r96 UTSW 17 18582538 missense possibly damaging 0.95
R6944:Vmn2r96 UTSW 17 18597629 missense probably benign 0.16
R6949:Vmn2r96 UTSW 17 18597838 missense probably damaging 1.00
R6962:Vmn2r96 UTSW 17 18598021 missense probably damaging 0.99
R6990:Vmn2r96 UTSW 17 18583820 missense probably benign
R7149:Vmn2r96 UTSW 17 18597727 missense possibly damaging 0.89
R7346:Vmn2r96 UTSW 17 18582767 missense probably benign 0.15
R7385:Vmn2r96 UTSW 17 18583040 missense probably damaging 1.00
R7442:Vmn2r96 UTSW 17 18573400 missense probably benign 0.02
R7509:Vmn2r96 UTSW 17 18582733 missense probably benign 0.02
R7652:Vmn2r96 UTSW 17 18573570 missense probably benign
R7659:Vmn2r96 UTSW 17 18573487 missense probably benign 0.00
R7753:Vmn2r96 UTSW 17 18586401 missense possibly damaging 0.46
R7855:Vmn2r96 UTSW 17 18597868 missense possibly damaging 0.59
R8166:Vmn2r96 UTSW 17 18582482 missense probably damaging 1.00
R8260:Vmn2r96 UTSW 17 18583981 missense probably benign 0.04
R8323:Vmn2r96 UTSW 17 18582761 missense probably damaging 0.99
R8787:Vmn2r96 UTSW 17 18597988 missense probably damaging 1.00
R8837:Vmn2r96 UTSW 17 18582626 missense probably benign
R8933:Vmn2r96 UTSW 17 18583979 missense probably benign 0.11
R9306:Vmn2r96 UTSW 17 18582964 missense probably benign 0.00
Z1088:Vmn2r96 UTSW 17 18597366 missense possibly damaging 0.86
Z1177:Vmn2r96 UTSW 17 18598114 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCCAGTTCATCTGTTCATGATAAGG -3'
(R):5'- CAAATCCAAATTTTCTCACCTGTGG -3'

Sequencing Primer
(F):5'- CAATTTGCCATTGAGGAGA -3'
(R):5'- CCTGTGGAAATTTAAAGAGTTGAAGC -3'
Posted On 2018-09-12