Incidental Mutation 'R6907:Nob1'
ID538823
Institutional Source Beutler Lab
Gene Symbol Nob1
Ensembl Gene ENSMUSG00000003848
Gene NameNIN1/RPN12 binding protein 1 homolog
SynonymsART-4, Nob1p, Psmd8bp1, 1700021I09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R6907 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location107412486-107425051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 107416228 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 274 (V274M)
Ref Sequence ENSEMBL: ENSMUSP00000003946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003946] [ENSMUST00000169311]
PDB Structure
Solution Structure of RSGI RUH-035, a Zn-ribbon module in Mouse cDNA [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003946
AA Change: V274M

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000003946
Gene: ENSMUSG00000003848
AA Change: V274M

DomainStartEndE-ValueType
PINc 5 108 2.28e-6 SMART
Pfam:AF1Q 135 211 1.8e-30 PFAM
Pfam:NOB1_Zn_bind 251 323 1e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165266
SMART Domains Protein: ENSMUSP00000129298
Gene: ENSMUSG00000003848

DomainStartEndE-ValueType
Blast:PINc 5 61 9e-34 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000169311
AA Change: S141N

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000126868
Gene: ENSMUSG00000003848
AA Change: S141N

DomainStartEndE-ValueType
PINc 5 108 2.28e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In yeast, over 200 protein and RNA cofactors are required for ribosome assembly, and these are generally conserved in eukaryotes. These factors orchestrate modification and cleavage of the initial 35S precursor rRNA transcript into the mature 18S, 5.8S, and 25S rRNAs, folding of the rRNA, and binding of ribosomal proteins and 5S RNA. Nob1 is involved in pre-rRNA processing. In a late cytoplasmic processing step, Nob1 cleaves a 20S rRNA intermediate at cleavage site D to produce the mature 18S rRNA (Lamanna and Karbstein, 2009 [PubMed 19706509]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 T C 8: 111,972,161 I344V probably benign Het
Bmper A T 9: 23,399,572 Q434L probably damaging Het
Cabyr A G 18: 12,750,912 Y152C probably benign Het
Cactin G A 10: 81,323,444 probably null Het
Cadps2 T C 6: 23,599,506 D238G probably damaging Het
Card10 T C 15: 78,787,471 T598A possibly damaging Het
Ctr9 C T 7: 111,030,242 P25L probably damaging Het
Entpd5 T C 12: 84,377,353 T409A probably benign Het
Exd1 A G 2: 119,533,476 V137A probably damaging Het
Fcgbp G A 7: 28,085,018 G168R probably damaging Het
Ift88 A G 14: 57,445,610 N248S probably benign Het
Kntc1 T A 5: 123,801,825 Y1561N probably damaging Het
Mef2c A G 13: 83,654,611 D227G probably benign Het
Myh2 C T 11: 67,193,741 T1702M probably damaging Het
Myo1e T A 9: 70,327,155 N263K probably benign Het
Nfe2l1 A G 11: 96,819,810 L373P probably damaging Het
Ntng2 A G 2: 29,228,206 C77R probably damaging Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr288 T C 15: 98,187,768 N10D probably damaging Het
Olfr476 T C 7: 107,968,252 L285P probably damaging Het
Pcdh7 T A 5: 57,719,129 W9R possibly damaging Het
Pcdha1 A G 18: 36,931,071 T263A probably benign Het
Per3 C T 4: 151,043,558 probably null Het
Pgbd5 A G 8: 124,380,282 F265L probably damaging Het
Ppm1k T G 6: 57,510,770 E356A probably benign Het
Ptgfr G T 3: 151,835,301 T190K possibly damaging Het
Sec24a A G 11: 51,712,276 Y782H probably damaging Het
Setd1b T C 5: 123,163,232 probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Slc19a2 C T 1: 164,262,754 T253I possibly damaging Het
Tcf4 C T 18: 69,652,413 T207M probably damaging Het
Thada T C 17: 84,393,469 N1203S probably damaging Het
Tln2 A T 9: 67,397,635 S5T probably damaging Het
Traf4 C T 11: 78,160,442 R296Q probably benign Het
Ttbk2 A G 2: 120,825,270 S38P probably benign Het
Vrk1 G T 12: 106,075,032 Q395H possibly damaging Het
Vwa3a G T 7: 120,792,581 probably benign Het
Wdsub1 C T 2: 59,861,684 V335I possibly damaging Het
Other mutations in Nob1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Nob1 APN 8 107424728 splice site probably benign
IGL01661:Nob1 APN 8 107413182 missense probably damaging 1.00
IGL02110:Nob1 APN 8 107416172 makesense probably null
IGL03373:Nob1 APN 8 107418046 intron probably benign
PIT4531001:Nob1 UTSW 8 107418417 missense probably benign 0.01
R0627:Nob1 UTSW 8 107416224 missense probably damaging 1.00
R1181:Nob1 UTSW 8 107421490 missense probably damaging 1.00
R1264:Nob1 UTSW 8 107421504 missense probably damaging 0.99
R2257:Nob1 UTSW 8 107417097 intron probably benign
R4402:Nob1 UTSW 8 107418488 intron probably benign
R5330:Nob1 UTSW 8 107416249 missense probably damaging 1.00
R7702:Nob1 UTSW 8 107413105 nonsense probably null
R8412:Nob1 UTSW 8 107421598 nonsense probably null
X0017:Nob1 UTSW 8 107424833 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCCCAGTTCTCTCAAGTTAG -3'
(R):5'- GGGGTATTTGGCACAGGACATG -3'

Sequencing Primer
(F):5'- CCAGTTCTCTCAAGTTAGGGGTTC -3'
(R):5'- TGGCCACGGTCTGACATC -3'
Posted On2018-11-06