Incidental Mutation 'R6949:Fbxw22'
ID543249
Institutional Source Beutler Lab
Gene Symbol Fbxw22
Ensembl Gene ENSMUSG00000070324
Gene NameF-box and WD-40 domain protein 22
SynonymsGm5164
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6949 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location109378400-109404296 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 109382076 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 386 (W386R)
Ref Sequence ENSEMBL: ENSMUSP00000079460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080626] [ENSMUST00000197213]
Predicted Effect probably benign
Transcript: ENSMUST00000080626
AA Change: W386R

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000079460
Gene: ENSMUSG00000070324
AA Change: W386R

DomainStartEndE-ValueType
FBOX 5 45 1.02e-5 SMART
SCOP:d1gxra_ 128 220 1e-5 SMART
Blast:WD40 137 176 6e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000197213
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 95.1%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 G T 3: 127,010,884 D679E probably benign Het
Catsper4 A T 4: 134,225,747 Y96N probably benign Het
Cnksr3 T C 10: 7,160,757 I35V probably benign Het
Col16a1 A G 4: 130,059,323 E424G probably damaging Het
Ctsc G T 7: 88,281,458 G82W probably damaging Het
Cxcr4 T C 1: 128,589,615 D101G probably benign Het
Dapk1 T A 13: 60,736,324 N635K probably benign Het
Dopey1 T C 9: 86,500,860 M282T probably damaging Het
Dpysl4 G A 7: 139,091,999 E172K probably damaging Het
Eif2ak3 T C 6: 70,878,845 I211T probably damaging Het
Fam71f1 T A 6: 29,323,906 I210N probably damaging Het
Gm11639 A C 11: 104,909,070 T2931P probably damaging Het
Grm7 A G 6: 110,646,304 K146R probably benign Het
Grm7 C A 6: 111,495,729 P843Q probably damaging Het
Gtf2e2 A G 8: 33,758,698 D171G probably damaging Het
Hyal5 T C 6: 24,876,304 S59P probably benign Het
Il7r T A 15: 9,508,004 T411S probably damaging Het
Kcp T A 6: 29,484,612 probably null Het
Krcc1 T C 6: 71,284,151 Y56H probably benign Het
Lmo2 T A 2: 103,970,673 M1K probably null Het
Lrit3 G A 3: 129,789,285 T351I probably damaging Het
Mcu T G 10: 59,456,744 T38P possibly damaging Het
Mylk T A 16: 35,000,318 I89N probably damaging Het
Ncoa2 A T 1: 13,156,501 C996S possibly damaging Het
Npr2 A G 4: 43,640,597 E350G probably damaging Het
Olfr1437 T C 19: 12,322,428 Y133C probably damaging Het
Pald1 T C 10: 61,321,217 E818G probably benign Het
Phf19 G T 2: 34,904,131 Q210K probably damaging Het
Pomgnt1 G A 4: 116,154,154 V250M probably damaging Het
Ppm1l T A 3: 69,549,403 C218S possibly damaging Het
Prkdc G A 16: 15,799,989 R3228H probably benign Het
Pros1 A T 16: 62,924,575 T518S probably benign Het
Rdh8 T A 9: 20,822,707 V63D probably benign Het
Rexo1 A G 10: 80,550,636 V196A possibly damaging Het
Scgb2b20 A T 7: 33,366,299 M1K probably null Het
Scn11a A G 9: 119,765,514 V1271A probably benign Het
Serac1 C A 17: 6,051,815 D395Y probably damaging Het
Syne2 A G 12: 75,965,997 D2655G probably benign Het
Tm4sf19 T C 16: 32,405,858 V8A probably benign Het
Usp3 A T 9: 66,520,690 D334E probably benign Het
Uty C T Y: 1,240,000 probably null Het
Vmn2r7 T C 3: 64,691,121 N672D probably damaging Het
Vmn2r96 T A 17: 18,597,838 L751H probably damaging Het
Wnk2 T C 13: 49,101,140 S300G probably damaging Het
Zp3r G T 1: 130,577,895 S508R probably benign Het
Other mutations in Fbxw22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Fbxw22 APN 9 109384040 missense possibly damaging 0.68
IGL00655:Fbxw22 APN 9 109382244 splice site probably benign
IGL01122:Fbxw22 APN 9 109386671 missense probably damaging 0.99
IGL01419:Fbxw22 APN 9 109381722 missense probably benign 0.03
IGL01455:Fbxw22 APN 9 109384994 missense probably benign
IGL01486:Fbxw22 APN 9 109378873 missense probably damaging 1.00
IGL01734:Fbxw22 APN 9 109383925 missense probably damaging 0.98
IGL02106:Fbxw22 APN 9 109402019 missense possibly damaging 0.86
IGL02255:Fbxw22 APN 9 109386551 splice site probably benign
IGL02466:Fbxw22 APN 9 109385092 missense probably damaging 1.00
IGL02820:Fbxw22 APN 9 109386664 missense probably damaging 1.00
R0395:Fbxw22 UTSW 9 109381685 missense probably damaging 1.00
R0705:Fbxw22 UTSW 9 109403096 missense possibly damaging 0.92
R0741:Fbxw22 UTSW 9 109382219 missense probably benign 0.01
R1603:Fbxw22 UTSW 9 109378847 missense probably benign 0.00
R1673:Fbxw22 UTSW 9 109382128 missense possibly damaging 0.93
R1874:Fbxw22 UTSW 9 109385111 nonsense probably null
R2265:Fbxw22 UTSW 9 109383994 missense probably benign 0.02
R2269:Fbxw22 UTSW 9 109383994 missense probably benign 0.02
R2385:Fbxw22 UTSW 9 109382142 missense probably damaging 1.00
R4329:Fbxw22 UTSW 9 109384043 missense probably damaging 1.00
R4695:Fbxw22 UTSW 9 109378871 missense probably damaging 1.00
R4731:Fbxw22 UTSW 9 109378869 missense probably benign 0.02
R4915:Fbxw22 UTSW 9 109383941 missense probably damaging 1.00
R5010:Fbxw22 UTSW 9 109403424 missense probably benign 0.40
R5070:Fbxw22 UTSW 9 109385115 missense probably benign
R5319:Fbxw22 UTSW 9 109383947 missense possibly damaging 0.52
R5571:Fbxw22 UTSW 9 109403088 missense probably damaging 1.00
R5765:Fbxw22 UTSW 9 109384996 missense probably benign 0.00
R5846:Fbxw22 UTSW 9 109386761 missense probably benign
R6002:Fbxw22 UTSW 9 109381682 nonsense probably null
R6180:Fbxw22 UTSW 9 109386679 missense probably damaging 1.00
R6313:Fbxw22 UTSW 9 109403397 missense probably damaging 0.99
R6860:Fbxw22 UTSW 9 109383962 missense probably benign 0.01
R7084:Fbxw22 UTSW 9 109404223 missense probably damaging 1.00
R7296:Fbxw22 UTSW 9 109382075 missense probably benign
R8499:Fbxw22 UTSW 9 109385000 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTAGGCTGCAGTCAATGTCAG -3'
(R):5'- GATACAGAATATTTGACAGCCAGC -3'

Sequencing Primer
(F):5'- TGCTCTGAGCCCATGTAAAG -3'
(R):5'- CAGAATATTTGACAGCCAGCTTCTCG -3'
Posted On2018-11-28