Incidental Mutation 'R7019:BC067074'
ID545525
Institutional Source Beutler Lab
Gene Symbol BC067074
Ensembl Gene ENSMUSG00000021763
Gene NamecDNA sequence BC067074
Synonyms
MMRRC Submission
Accession Numbers

Ncbi RefSeq: none; VEGA: OTTMUST00000084794; MGI:3040697

Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R7019 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location113293159-113379711 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 113351750 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 102 (T102I)
Ref Sequence ENSEMBL: ENSMUSP00000077297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078163] [ENSMUST00000136755]
Predicted Effect probably benign
Transcript: ENSMUST00000078163
AA Change: T102I

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000077297
Gene: ENSMUSG00000021763
AA Change: T102I

DomainStartEndE-ValueType
Pfam:Cadherin_3 29 136 4.6e-12 PFAM
low complexity region 190 198 N/A INTRINSIC
Pfam:Cadherin_3 231 384 4.9e-38 PFAM
transmembrane domain 725 747 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000131959
Gene: ENSMUSG00000021763
AA Change: T49I

DomainStartEndE-ValueType
Pfam:Cadherin_3 1 86 1.1e-9 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000119993
Gene: ENSMUSG00000021763
AA Change: T1644I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LamG 44 177 1.28e-20 SMART
LamG 229 371 4.66e-14 SMART
low complexity region 407 420 N/A INTRINSIC
Pfam:Cadherin_3 492 644 2.1e-35 PFAM
Pfam:Cadherin_3 647 759 1e-7 PFAM
Pfam:Cadherin_3 741 873 1.2e-8 PFAM
Pfam:Cadherin_3 861 989 4.1e-14 PFAM
Pfam:Cadherin_3 958 1114 1.2e-20 PFAM
Pfam:Cadherin_3 1117 1223 1.6e-10 PFAM
Pfam:Cadherin_3 1212 1341 5.6e-12 PFAM
Pfam:Cadherin_3 1347 1438 3.8e-8 PFAM
Pfam:Cadherin_3 1419 1562 2.3e-45 PFAM
Pfam:Cadherin_3 1576 1679 2.1e-9 PFAM
low complexity region 1732 1740 N/A INTRINSIC
Pfam:Cadherin_3 1773 1926 3e-35 PFAM
transmembrane domain 2267 2289 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (61/61)
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat A T 16: 8,618,531 K414* probably null Het
Aco1 T A 4: 40,186,376 I596N probably damaging Het
Adgre1 A C 17: 57,410,945 D319A probably damaging Het
Birc6 T C 17: 74,609,345 V445A probably benign Het
Btd A C 14: 31,667,105 Q261P probably damaging Het
Btd G T 14: 31,667,106 Q261H possibly damaging Het
C7 T A 15: 5,045,682 Y176F probably benign Het
Ccdc102a T C 8: 94,909,803 S287G probably benign Het
Ccdc178 T A 18: 22,150,438 T12S probably benign Het
Cnga4 G T 7: 105,405,829 A104S probably benign Het
Col10a1 G T 10: 34,394,951 L306F probably damaging Het
Cpne5 T C 17: 29,226,222 D36G probably damaging Het
Csmd2 G A 4: 128,369,063 D681N Het
Cstl1 A G 2: 148,755,303 M75V probably benign Het
Cyp26a1 T C 19: 37,698,812 L149P probably damaging Het
D630045J12Rik T G 6: 38,194,635 E866A probably benign Het
Dlec1 C T 9: 119,112,422 P292L probably benign Het
Dpp3 T G 19: 4,916,789 E402A possibly damaging Het
Egf T C 3: 129,718,064 probably null Het
Epha5 T C 5: 84,416,462 Q15R possibly damaging Het
Esyt3 A G 9: 99,315,285 F831L probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fut7 A G 2: 25,425,780 D350G probably benign Het
Gab1 C A 8: 80,784,817 E466D probably damaging Het
Glrp1 A T 1: 88,503,168 M160K unknown Het
Gngt1 T C 6: 3,994,088 probably null Het
Gprc6a A T 10: 51,631,412 V7E possibly damaging Het
Idh3b A T 2: 130,280,966 V301D probably damaging Het
Ifi202b A C 1: 173,963,958 C385G probably benign Het
Ilvbl T A 10: 78,579,086 L261Q probably damaging Het
Irx6 T A 8: 92,678,734 L410Q probably damaging Het
Ism2 T C 12: 87,299,663 M15V unknown Het
Itih5 C A 2: 10,190,327 R177S probably damaging Het
Klra3 C T 6: 130,327,124 G202R probably damaging Het
Krt7 T C 15: 101,413,970 V103A probably damaging Het
Lama3 T C 18: 12,528,418 S2145P probably damaging Het
Mlph A G 1: 90,941,706 R477G probably damaging Het
Mybpc1 T A 10: 88,543,719 L653F probably damaging Het
Myrfl A G 10: 116,781,947 probably null Het
Myrip T G 9: 120,422,507 L232R probably damaging Het
Nrd1 A T 4: 109,028,802 H126L probably benign Het
Olfr251 T A 9: 38,378,802 L307Q possibly damaging Het
Olfr469 G T 7: 107,823,158 L104I probably benign Het
Olfr722 A T 14: 49,895,667 I45N probably damaging Het
Pcdhb10 T A 18: 37,413,003 N377K probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Prkdc A C 16: 15,769,966 I2572L probably benign Het
Ptpro C A 6: 137,380,478 D322E probably benign Het
R3hcc1 A G 14: 69,704,125 I332T probably damaging Het
Rab8a T C 8: 72,161,383 F9L probably damaging Het
Ranbp3l A T 15: 9,057,160 K165N probably damaging Het
Rock2 T A 12: 16,977,740 C1353S probably damaging Het
Rsad2 T A 12: 26,456,419 M1L possibly damaging Het
Tymp A T 15: 89,376,281 probably null Het
Vmn1r104 A G 7: 20,534,566 M244V probably benign Het
Vmn1r232 G A 17: 20,913,285 T351M possibly damaging Het
Vmn2r50 A G 7: 10,050,245 Y101H probably benign Het
Vmn2r57 A G 7: 41,428,665 L123P probably damaging Het
Wdr17 T C 8: 54,681,453 N331D probably damaging Het
Wdr47 C T 3: 108,614,355 Q89* probably null Het
Zcchc4 A T 5: 52,784,033 T57S probably benign Het
Other mutations in BC067074
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01723:BC067074 APN 13 113367557 missense possibly damaging 0.91
IGL03023:BC067074 APN 13 113351741 missense probably benign 0.03
cumpleanos UTSW 13 113368336 missense possibly damaging 0.87
Sorpresa UTSW 13 113318191 missense probably damaging 1.00
P0018:BC067074 UTSW 13 113367506 missense possibly damaging 0.60
R0003:BC067074 UTSW 13 113368776 missense probably benign 0.00
R0016:BC067074 UTSW 13 113366105 missense probably damaging 1.00
R0016:BC067074 UTSW 13 113366105 missense probably damaging 1.00
R0053:BC067074 UTSW 13 113368489 missense probably benign 0.00
R0053:BC067074 UTSW 13 113368489 missense probably benign 0.00
R0158:BC067074 UTSW 13 113369153 nonsense probably null
R0281:BC067074 UTSW 13 113369143 missense probably damaging 1.00
R1212:BC067074 UTSW 13 113369417 intron probably benign
R1300:BC067074 UTSW 13 113366160 missense probably damaging 1.00
R1434:BC067074 UTSW 13 113368492 missense possibly damaging 0.46
R1509:BC067074 UTSW 13 113368256 missense probably damaging 0.99
R1738:BC067074 UTSW 13 113367500 missense possibly damaging 0.69
R1758:BC067074 UTSW 13 113368732 missense possibly damaging 0.78
R1828:BC067074 UTSW 13 113368808 missense probably damaging 1.00
R2061:BC067074 UTSW 13 113318094 missense probably damaging 0.99
R2570:BC067074 UTSW 13 113318587 missense probably benign 0.34
R2884:BC067074 UTSW 13 113320682 missense probably damaging 1.00
R2884:BC067074 UTSW 13 113369191 missense probably benign 0.00
R3004:BC067074 UTSW 13 113366154 missense probably damaging 1.00
R3150:BC067074 UTSW 13 113351760 missense probably damaging 1.00
R3773:BC067074 UTSW 13 113318209 missense probably benign 0.12
R3864:BC067074 UTSW 13 113322951 missense possibly damaging 0.64
R3971:BC067074 UTSW 13 113317126 missense probably damaging 1.00
R4004:BC067074 UTSW 13 113318380 missense probably benign 0.00
R4271:BC067074 UTSW 13 113342370 missense possibly damaging 0.76
R4382:BC067074 UTSW 13 113322754 missense probably benign 0.10
R4484:BC067074 UTSW 13 113319199 missense probably damaging 0.98
R4570:BC067074 UTSW 13 113318191 missense probably damaging 1.00
R4600:BC067074 UTSW 13 113319249 missense possibly damaging 0.95
R4622:BC067074 UTSW 13 113320081 missense probably benign 0.00
R4676:BC067074 UTSW 13 113368807 missense probably damaging 0.98
R4676:BC067074 UTSW 13 113368808 missense probably damaging 1.00
R4677:BC067074 UTSW 13 113379486 missense unknown
R4775:BC067074 UTSW 13 113317695 missense possibly damaging 0.91
R4779:BC067074 UTSW 13 113368336 missense possibly damaging 0.87
R4780:BC067074 UTSW 13 113317858 missense probably damaging 1.00
R4829:BC067074 UTSW 13 113368162 missense probably benign 0.05
R4841:BC067074 UTSW 13 113366190 missense probably benign 0.00
R4879:BC067074 UTSW 13 113319787 missense probably benign 0.03
R4930:BC067074 UTSW 13 113327662 missense probably damaging 1.00
R4934:BC067074 UTSW 13 113368348 missense probably damaging 1.00
R4987:BC067074 UTSW 13 113318101 missense probably benign 0.07
R5065:BC067074 UTSW 13 113320919 missense probably benign 0.01
R5216:BC067074 UTSW 13 113342413 missense probably benign 0.20
R5236:BC067074 UTSW 13 113366220 missense probably benign 0.14
R5247:BC067074 UTSW 13 113319459 missense probably damaging 1.00
R5250:BC067074 UTSW 13 113319771 missense possibly damaging 0.95
R5337:BC067074 UTSW 13 113318765 missense probably damaging 1.00
R5342:BC067074 UTSW 13 113366269 critical splice donor site probably null
R5426:BC067074 UTSW 13 113369053 missense probably benign 0.01
R5472:BC067074 UTSW 13 113319169 missense probably benign 0.12
R5526:BC067074 UTSW 13 113367893 missense probably benign 0.22
R5543:BC067074 UTSW 13 113320873 missense probably damaging 0.96
R5589:BC067074 UTSW 13 113317950 missense possibly damaging 0.95
R5623:BC067074 UTSW 13 113346634 missense possibly damaging 0.95
R5668:BC067074 UTSW 13 113317167 missense possibly damaging 0.55
R5793:BC067074 UTSW 13 113321022 missense possibly damaging 0.75
R5824:BC067074 UTSW 13 113368620 missense probably damaging 1.00
R6038:BC067074 UTSW 13 113318619 missense possibly damaging 0.49
R6038:BC067074 UTSW 13 113318619 missense possibly damaging 0.49
R6053:BC067074 UTSW 13 113320726 missense possibly damaging 0.51
R6125:BC067074 UTSW 13 113317683 missense probably benign 0.00
R6129:BC067074 UTSW 13 113368806 nonsense probably null
R6290:BC067074 UTSW 13 113319958 missense probably damaging 0.97
R6291:BC067074 UTSW 13 113320447 missense possibly damaging 0.85
R6302:BC067074 UTSW 13 113368112 missense probably damaging 1.00
R6317:BC067074 UTSW 13 113368268 missense probably benign 0.09
R6395:BC067074 UTSW 13 113369469 missense probably damaging 1.00
R6673:BC067074 UTSW 13 113367832 nonsense probably null
R6783:BC067074 UTSW 13 113320209 nonsense probably null
R6800:BC067074 UTSW 13 113368152 missense probably benign 0.02
R6857:BC067074 UTSW 13 113319958 missense probably damaging 0.97
R6889:BC067074 UTSW 13 113318378 missense probably damaging 0.99
R6934:BC067074 UTSW 13 113369266 missense probably benign
R7100:BC067074 UTSW 13 113318967 missense
R7115:BC067074 UTSW 13 113320776 missense
R7152:BC067074 UTSW 13 113318850 missense
R7195:BC067074 UTSW 13 113367929 missense
R7213:BC067074 UTSW 13 113317941 missense
R7250:BC067074 UTSW 13 113318815 missense
R7341:BC067074 UTSW 13 113318172 missense
R7358:BC067074 UTSW 13 113319967 missense
R7359:BC067074 UTSW 13 113342430 missense
R7396:BC067074 UTSW 13 113318990 missense
R7632:BC067074 UTSW 13 113320886 missense
R7689:BC067074 UTSW 13 113379414 missense
R7713:BC067074 UTSW 13 113346541 missense
R7892:BC067074 UTSW 13 113319606 missense
R7975:BC067074 UTSW 13 113319307 missense
R8017:BC067074 UTSW 13 113319623 missense
R8019:BC067074 UTSW 13 113319623 missense
R8034:BC067074 UTSW 13 113342511 missense
R8101:BC067074 UTSW 13 113320891 missense
R8104:BC067074 UTSW 13 113319729 missense
R8122:BC067074 UTSW 13 113318908 missense
R8126:BC067074 UTSW 13 113368163 missense
R8272:BC067074 UTSW 13 113368355 missense
Predicted Primers PCR Primer
(F):5'- CCCCTTTGTGCAGGTTGTAG -3'
(R):5'- CAGCAATGGTGTTTTCTGACATC -3'

Sequencing Primer
(F):5'- CCTTTGTGCAGGTTGTAGTTATATTC -3'
(R):5'- ATCTCATGTTCTGCTCCCTAAAATG -3'
Posted On2019-05-13