Incidental Mutation 'R7019:Epha5'
ID545497
Institutional Source Beutler Lab
Gene Symbol Epha5
Ensembl Gene ENSMUSG00000029245
Gene NameEph receptor A5
SynonymsRek7, Ehk1, Hek7, Cek7, bsk, Els1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7019 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location84054761-84417382 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84416462 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 15 (Q15R)
Ref Sequence ENSEMBL: ENSMUSP00000109033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053733] [ENSMUST00000113398] [ENSMUST00000113399] [ENSMUST00000113401] [ENSMUST00000113403] [ENSMUST00000113406]
Predicted Effect unknown
Transcript: ENSMUST00000053733
AA Change: Q15R
SMART Domains Protein: ENSMUSP00000060646
Gene: ENSMUSG00000029245
AA Change: Q15R

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 307 387 1.92e-12 SMART
Pfam:EphA2_TM 413 511 2.1e-22 PFAM
TyrKc 514 771 9.33e-138 SMART
SAM 801 868 6.65e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113398
AA Change: Q15R

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000109025
Gene: ENSMUSG00000029245
AA Change: Q15R

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 359 439 1.92e-12 SMART
Pfam:EphA2_TM 465 563 8.4e-23 PFAM
TyrKc 566 823 9.33e-138 SMART
Pfam:SAM_1 854 894 7.2e-11 PFAM
Pfam:SAM_2 856 894 1.6e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113399
AA Change: Q15R

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109026
Gene: ENSMUSG00000029245
AA Change: Q15R

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 360 450 1.53e-6 SMART
FN3 471 551 1.92e-12 SMART
Pfam:EphA2_TM 577 675 3.4e-22 PFAM
TyrKc 678 935 9.33e-138 SMART
Pfam:SAM_1 966 1006 2.9e-10 PFAM
Pfam:SAM_2 968 1006 5.9e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113401
AA Change: Q15R

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109028
Gene: ENSMUSG00000029245
AA Change: Q15R

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 307 387 1.92e-12 SMART
Pfam:EphA2_TM 411 488 3.1e-30 PFAM
TyrKc 491 748 9.33e-138 SMART
Pfam:SAM_1 779 819 1.7e-10 PFAM
Pfam:SAM_2 781 819 3.5e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113403
AA Change: Q15R

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109030
Gene: ENSMUSG00000029245
AA Change: Q15R

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 360 450 1.53e-6 SMART
FN3 471 551 1.92e-12 SMART
Pfam:EphA2_TM 577 675 1.2e-25 PFAM
TyrKc 678 935 9.33e-138 SMART
SAM 965 1032 6.65e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113406
AA Change: Q15R

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109033
Gene: ENSMUSG00000029245
AA Change: Q15R

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 360 450 1.53e-6 SMART
FN3 471 551 1.92e-12 SMART
Pfam:EphA2_TM 575 652 1.9e-30 PFAM
TyrKc 655 912 9.33e-138 SMART
SAM 942 1009 6.65e-23 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous mutant mice are overtly normal but show abnormal retinal axon mapping. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat A T 16: 8,618,531 K414* probably null Het
Aco1 T A 4: 40,186,376 I596N probably damaging Het
Adgre1 A C 17: 57,410,945 D319A probably damaging Het
BC067074 C T 13: 113,351,750 T102I probably benign Het
Birc6 T C 17: 74,609,345 V445A probably benign Het
Btd A C 14: 31,667,105 Q261P probably damaging Het
Btd G T 14: 31,667,106 Q261H possibly damaging Het
C7 T A 15: 5,045,682 Y176F probably benign Het
Ccdc102a T C 8: 94,909,803 S287G probably benign Het
Ccdc178 T A 18: 22,150,438 T12S probably benign Het
Cnga4 G T 7: 105,405,829 A104S probably benign Het
Col10a1 G T 10: 34,394,951 L306F probably damaging Het
Cpne5 T C 17: 29,226,222 D36G probably damaging Het
Csmd2 G A 4: 128,369,063 D681N Het
Cstl1 A G 2: 148,755,303 M75V probably benign Het
Cyp26a1 T C 19: 37,698,812 L149P probably damaging Het
D630045J12Rik T G 6: 38,194,635 E866A probably benign Het
Dlec1 C T 9: 119,112,422 P292L probably benign Het
Dpp3 T G 19: 4,916,789 E402A possibly damaging Het
Egf T C 3: 129,718,064 probably null Het
Esyt3 A G 9: 99,315,285 F831L probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fut7 A G 2: 25,425,780 D350G probably benign Het
Gab1 C A 8: 80,784,817 E466D probably damaging Het
Glrp1 A T 1: 88,503,168 M160K unknown Het
Gngt1 T C 6: 3,994,088 probably null Het
Gprc6a A T 10: 51,631,412 V7E possibly damaging Het
Idh3b A T 2: 130,280,966 V301D probably damaging Het
Ifi202b A C 1: 173,963,958 C385G probably benign Het
Ilvbl T A 10: 78,579,086 L261Q probably damaging Het
Irx6 T A 8: 92,678,734 L410Q probably damaging Het
Ism2 T C 12: 87,299,663 M15V unknown Het
Itih5 C A 2: 10,190,327 R177S probably damaging Het
Klra3 C T 6: 130,327,124 G202R probably damaging Het
Krt7 T C 15: 101,413,970 V103A probably damaging Het
Lama3 T C 18: 12,528,418 S2145P probably damaging Het
Mlph A G 1: 90,941,706 R477G probably damaging Het
Mybpc1 T A 10: 88,543,719 L653F probably damaging Het
Myrfl A G 10: 116,781,947 probably null Het
Myrip T G 9: 120,422,507 L232R probably damaging Het
Nrd1 A T 4: 109,028,802 H126L probably benign Het
Olfr251 T A 9: 38,378,802 L307Q possibly damaging Het
Olfr469 G T 7: 107,823,158 L104I probably benign Het
Olfr722 A T 14: 49,895,667 I45N probably damaging Het
Pcdhb10 T A 18: 37,413,003 N377K probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Prkdc A C 16: 15,769,966 I2572L probably benign Het
Ptpro C A 6: 137,380,478 D322E probably benign Het
R3hcc1 A G 14: 69,704,125 I332T probably damaging Het
Rab8a T C 8: 72,161,383 F9L probably damaging Het
Ranbp3l A T 15: 9,057,160 K165N probably damaging Het
Rock2 T A 12: 16,977,740 C1353S probably damaging Het
Rsad2 T A 12: 26,456,419 M1L possibly damaging Het
Tymp A T 15: 89,376,281 probably null Het
Vmn1r104 A G 7: 20,534,566 M244V probably benign Het
Vmn1r232 G A 17: 20,913,285 T351M possibly damaging Het
Vmn2r50 A G 7: 10,050,245 Y101H probably benign Het
Vmn2r57 A G 7: 41,428,665 L123P probably damaging Het
Wdr17 T C 8: 54,681,453 N331D probably damaging Het
Wdr47 C T 3: 108,614,355 Q89* probably null Het
Zcchc4 A T 5: 52,784,033 T57S probably benign Het
Other mutations in Epha5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00808:Epha5 APN 5 84106700 missense probably damaging 1.00
IGL01084:Epha5 APN 5 84071087 nonsense probably null
IGL01462:Epha5 APN 5 84071233 missense probably damaging 1.00
IGL01516:Epha5 APN 5 84386276 missense probably damaging 1.00
IGL01998:Epha5 APN 5 84084734 missense probably damaging 1.00
IGL02744:Epha5 APN 5 84107989 missense probably benign 0.22
IGL03076:Epha5 APN 5 84331690 missense probably damaging 1.00
IGL03123:Epha5 APN 5 84331226 critical splice donor site probably null
IGL03381:Epha5 APN 5 84331332 missense probably damaging 0.98
BB001:Epha5 UTSW 5 84084846 missense possibly damaging 0.71
BB011:Epha5 UTSW 5 84084846 missense possibly damaging 0.71
PIT4544001:Epha5 UTSW 5 84331612 missense possibly damaging 0.71
R0004:Epha5 UTSW 5 84331842 missense probably damaging 1.00
R0490:Epha5 UTSW 5 84107974 splice site probably benign
R0545:Epha5 UTSW 5 84067358 critical splice donor site probably null
R0835:Epha5 UTSW 5 84386242 missense probably damaging 1.00
R1074:Epha5 UTSW 5 84150395 missense probably damaging 0.99
R1074:Epha5 UTSW 5 84150396 missense probably damaging 0.99
R1075:Epha5 UTSW 5 84150395 missense probably damaging 0.99
R1075:Epha5 UTSW 5 84150396 missense probably damaging 0.99
R1102:Epha5 UTSW 5 84233575 splice site probably benign
R1184:Epha5 UTSW 5 84071275 splice site probably null
R1255:Epha5 UTSW 5 84150395 missense probably damaging 0.99
R1255:Epha5 UTSW 5 84150396 missense probably damaging 0.99
R1327:Epha5 UTSW 5 84106785 missense probably damaging 1.00
R1437:Epha5 UTSW 5 84233696 missense probably damaging 1.00
R1804:Epha5 UTSW 5 84331815 missense probably benign 0.21
R1967:Epha5 UTSW 5 84416429 missense probably benign 0.23
R2187:Epha5 UTSW 5 84086364 missense probably damaging 1.00
R2282:Epha5 UTSW 5 84150410 missense probably damaging 1.00
R2899:Epha5 UTSW 5 84233808 missense probably damaging 0.99
R3746:Epha5 UTSW 5 84059104 missense probably damaging 1.00
R4454:Epha5 UTSW 5 84156444 missense probably damaging 1.00
R4771:Epha5 UTSW 5 84150419 missense probably damaging 0.99
R4809:Epha5 UTSW 5 84105891 missense possibly damaging 0.88
R4810:Epha5 UTSW 5 84105891 missense possibly damaging 0.88
R4825:Epha5 UTSW 5 84233840 missense probably damaging 0.97
R4833:Epha5 UTSW 5 84105891 missense possibly damaging 0.88
R4961:Epha5 UTSW 5 84233643 missense probably damaging 1.00
R4976:Epha5 UTSW 5 84084824 missense probably damaging 1.00
R4981:Epha5 UTSW 5 84150483 missense probably damaging 1.00
R5149:Epha5 UTSW 5 84150358 missense probably damaging 1.00
R5422:Epha5 UTSW 5 84331490 missense probably damaging 1.00
R5575:Epha5 UTSW 5 84416502 missense probably damaging 0.97
R5664:Epha5 UTSW 5 84331866 missense probably damaging 1.00
R5801:Epha5 UTSW 5 84331226 critical splice donor site probably null
R5821:Epha5 UTSW 5 84084728 missense probably damaging 1.00
R5924:Epha5 UTSW 5 84233674 nonsense probably null
R5951:Epha5 UTSW 5 84331192 intron probably benign
R5956:Epha5 UTSW 5 84150369 missense probably damaging 0.99
R6127:Epha5 UTSW 5 84071094 missense probably damaging 1.00
R6189:Epha5 UTSW 5 84237540 missense probably damaging 1.00
R6240:Epha5 UTSW 5 84117579 missense probably benign 0.27
R6343:Epha5 UTSW 5 84106747 missense probably damaging 1.00
R6463:Epha5 UTSW 5 84106710 missense probably damaging 1.00
R6517:Epha5 UTSW 5 84156501 missense possibly damaging 0.63
R6622:Epha5 UTSW 5 84237528 missense possibly damaging 0.79
R6667:Epha5 UTSW 5 84071191 missense probably damaging 1.00
R6741:Epha5 UTSW 5 84106698 missense possibly damaging 0.69
R6757:Epha5 UTSW 5 84105878 missense probably damaging 1.00
R6762:Epha5 UTSW 5 84331726 missense probably damaging 1.00
R6819:Epha5 UTSW 5 84106790 missense probably damaging 1.00
R7031:Epha5 UTSW 5 84142300 missense probably benign 0.12
R7213:Epha5 UTSW 5 84233923 splice site probably null
R7728:Epha5 UTSW 5 84067408 missense possibly damaging 0.95
R7924:Epha5 UTSW 5 84084846 missense possibly damaging 0.71
R7953:Epha5 UTSW 5 84233654 missense probably benign 0.19
R8043:Epha5 UTSW 5 84233654 missense probably benign 0.19
Z1088:Epha5 UTSW 5 84237522 missense probably benign 0.01
Z1176:Epha5 UTSW 5 84071120 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGAAGAGCGGGGATTTAGTCTC -3'
(R):5'- TCTGTGATTCCCGCATTTAGAG -3'

Sequencing Primer
(F):5'- GGATTTAGTCTCCGCAGCG -3'
(R):5'- CCGCATTTAGAGGGGTCGAG -3'
Posted On2019-05-13