Incidental Mutation 'R8034:BC067074'
ID 618145
Institutional Source Beutler Lab
Gene Symbol BC067074
Ensembl Gene ENSMUSG00000021763
Gene Name cDNA sequence BC067074
Synonyms
MMRRC Submission
Accession Numbers

Ncbi RefSeq: none; VEGA: OTTMUST00000084794; MGI:3040697

Is this an essential gene? Possibly non essential (E-score: 0.278) question?
Stock # R8034 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 113293159-113379711 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 113342511 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1530 (I1530F)
Ref Sequence ENSEMBL: ENSMUSP00000119993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078163] [ENSMUST00000136755]
AlphaFold F6RXI4
Predicted Effect probably benign
Transcript: ENSMUST00000078163
SMART Domains Protein: ENSMUSP00000077297
Gene: ENSMUSG00000021763

DomainStartEndE-ValueType
Pfam:Cadherin_3 29 136 4.6e-12 PFAM
low complexity region 190 198 N/A INTRINSIC
Pfam:Cadherin_3 231 384 4.9e-38 PFAM
transmembrane domain 725 747 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000119993
Gene: ENSMUSG00000021763
AA Change: I1530F

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LamG 44 177 1.28e-20 SMART
LamG 229 371 4.66e-14 SMART
low complexity region 407 420 N/A INTRINSIC
Pfam:Cadherin_3 492 644 2.1e-35 PFAM
Pfam:Cadherin_3 647 759 1e-7 PFAM
Pfam:Cadherin_3 741 873 1.2e-8 PFAM
Pfam:Cadherin_3 861 989 4.1e-14 PFAM
Pfam:Cadherin_3 958 1114 1.2e-20 PFAM
Pfam:Cadherin_3 1117 1223 1.6e-10 PFAM
Pfam:Cadherin_3 1212 1341 5.6e-12 PFAM
Pfam:Cadherin_3 1347 1438 3.8e-8 PFAM
Pfam:Cadherin_3 1419 1562 2.3e-45 PFAM
Pfam:Cadherin_3 1576 1679 2.1e-9 PFAM
low complexity region 1732 1740 N/A INTRINSIC
Pfam:Cadherin_3 1773 1926 3e-35 PFAM
transmembrane domain 2267 2289 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 A G 7: 101,394,773 T680A probably damaging Het
Asb3 C A 11: 31,081,554 Y391* probably null Het
Bean1 CT C 8: 104,182,032 probably null Het
C130026I21Rik T A 1: 85,254,160 T180S probably benign Het
Ccdc80 A G 16: 45,122,875 I783V probably damaging Het
Ccnf A G 17: 24,231,831 V391A probably damaging Het
Cd5l C A 3: 87,365,964 A80E possibly damaging Het
Chmp2b A T 16: 65,546,883 M96K probably benign Het
Dennd4a T C 9: 64,888,568 S725P probably benign Het
Dnah6 T C 6: 73,129,225 N1843S probably damaging Het
Dpy19l3 A G 7: 35,749,856 F41L probably benign Het
Eif3e A T 15: 43,272,307 M112K probably benign Het
Faim T C 9: 98,992,733 V111A possibly damaging Het
Fat1 A G 8: 44,951,691 E493G probably benign Het
Fsip2 A G 2: 82,989,355 D5144G possibly damaging Het
Fuz T C 7: 44,896,260 M1T probably null Het
Ggcx T C 6: 72,428,604 V529A possibly damaging Het
Gm7145 A T 1: 117,986,164 T259S probably benign Het
Gria2 T G 3: 80,801,699 T59P probably damaging Het
H2-Q10 A T 17: 35,470,441 I47F probably damaging Het
Heatr6 A G 11: 83,753,909 N63D probably benign Het
Ints7 CCGGATCG CCGGATCGGATCG 1: 191,613,068 probably null Het
Ints7 GATCG GATCGTATCG 1: 191,613,071 probably null Het
Lcn6 T A 2: 25,676,871 L19* probably null Het
Lhcgr T C 17: 88,742,356 T581A probably damaging Het
Map4k1 T C 7: 28,988,148 I203T probably damaging Het
Mctp1 G C 13: 76,891,551 L783F probably damaging Het
Mlf1 A T 3: 67,384,588 M29L probably damaging Het
Npas3 T A 12: 53,640,529 I159N probably damaging Het
Nup98 T C 7: 102,145,723 probably null Het
Olfr1238 A G 2: 89,406,737 V114A probably benign Het
Olfr1464-ps1 A G 19: 13,282,851 F69S probably damaging Het
Olfr572 A T 7: 102,928,566 K313* probably null Het
Olfr734 T C 14: 50,320,566 K90E probably damaging Het
Olfr867 A G 9: 20,055,005 F35L probably benign Het
Olfr890 T C 9: 38,143,677 Y176H probably damaging Het
Otud3 T C 4: 138,895,800 S377G probably benign Het
Pclo T A 5: 14,521,200 S200T probably damaging Het
Pex6 G C 17: 46,722,399 G616A possibly damaging Het
Pkhd1 T A 1: 20,381,438 H2211L possibly damaging Het
Sec13 T C 6: 113,735,089 K95R probably benign Het
Sema3c T C 5: 17,727,482 V661A probably damaging Het
Sema5a A G 15: 32,574,841 Y365C probably damaging Het
Sprr2h A T 3: 92,386,813 E61V unknown Het
Tead3 A C 17: 28,333,229 V365G probably damaging Het
Trpm7 T A 2: 126,846,199 N236I probably damaging Het
Ubxn2b A G 4: 6,191,167 E13G probably benign Het
Zfp639 C A 3: 32,520,066 A280E probably damaging Het
Other mutations in BC067074
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01723:BC067074 APN 13 113367557 missense possibly damaging 0.91
IGL03023:BC067074 APN 13 113351741 missense probably benign 0.03
cumpleanos UTSW 13 113368336 missense possibly damaging 0.87
Sorpresa UTSW 13 113318191 missense probably damaging 1.00
P0018:BC067074 UTSW 13 113367506 missense possibly damaging 0.60
R0003:BC067074 UTSW 13 113368776 missense probably benign 0.00
R0016:BC067074 UTSW 13 113366105 missense probably damaging 1.00
R0016:BC067074 UTSW 13 113366105 missense probably damaging 1.00
R0053:BC067074 UTSW 13 113368489 missense probably benign 0.00
R0053:BC067074 UTSW 13 113368489 missense probably benign 0.00
R0158:BC067074 UTSW 13 113369153 nonsense probably null
R0281:BC067074 UTSW 13 113369143 missense probably damaging 1.00
R1212:BC067074 UTSW 13 113369417 intron probably benign
R1300:BC067074 UTSW 13 113366160 missense probably damaging 1.00
R1434:BC067074 UTSW 13 113368492 missense possibly damaging 0.46
R1509:BC067074 UTSW 13 113368256 missense probably damaging 0.99
R1738:BC067074 UTSW 13 113367500 missense possibly damaging 0.69
R1758:BC067074 UTSW 13 113368732 missense possibly damaging 0.78
R1828:BC067074 UTSW 13 113368808 missense probably damaging 1.00
R2061:BC067074 UTSW 13 113318094 missense probably damaging 0.99
R2570:BC067074 UTSW 13 113318587 missense probably benign 0.34
R2884:BC067074 UTSW 13 113320682 missense probably damaging 1.00
R2884:BC067074 UTSW 13 113369191 missense probably benign 0.00
R3004:BC067074 UTSW 13 113366154 missense probably damaging 1.00
R3150:BC067074 UTSW 13 113351760 missense probably damaging 1.00
R3773:BC067074 UTSW 13 113318209 missense probably benign 0.12
R3864:BC067074 UTSW 13 113322951 missense possibly damaging 0.64
R3971:BC067074 UTSW 13 113317126 missense probably damaging 1.00
R4004:BC067074 UTSW 13 113318380 missense probably benign 0.00
R4271:BC067074 UTSW 13 113342370 missense possibly damaging 0.76
R4382:BC067074 UTSW 13 113322754 missense probably benign 0.10
R4484:BC067074 UTSW 13 113319199 missense probably damaging 0.98
R4570:BC067074 UTSW 13 113318191 missense probably damaging 1.00
R4600:BC067074 UTSW 13 113319249 missense possibly damaging 0.95
R4622:BC067074 UTSW 13 113320081 missense probably benign 0.00
R4676:BC067074 UTSW 13 113368807 missense probably damaging 0.98
R4676:BC067074 UTSW 13 113368808 missense probably damaging 1.00
R4677:BC067074 UTSW 13 113379486 missense unknown
R4775:BC067074 UTSW 13 113317695 missense possibly damaging 0.91
R4779:BC067074 UTSW 13 113368336 missense possibly damaging 0.87
R4780:BC067074 UTSW 13 113317858 missense probably damaging 1.00
R4829:BC067074 UTSW 13 113368162 missense probably benign 0.05
R4841:BC067074 UTSW 13 113366190 missense probably benign 0.00
R4879:BC067074 UTSW 13 113319787 missense probably benign 0.03
R4930:BC067074 UTSW 13 113327662 missense probably damaging 1.00
R4934:BC067074 UTSW 13 113368348 missense probably damaging 1.00
R4987:BC067074 UTSW 13 113318101 missense probably benign 0.07
R5065:BC067074 UTSW 13 113320919 missense probably benign 0.01
R5216:BC067074 UTSW 13 113342413 missense probably benign 0.20
R5236:BC067074 UTSW 13 113366220 missense probably benign 0.14
R5247:BC067074 UTSW 13 113319459 missense probably damaging 1.00
R5250:BC067074 UTSW 13 113319771 missense possibly damaging 0.95
R5337:BC067074 UTSW 13 113318765 missense probably damaging 1.00
R5342:BC067074 UTSW 13 113366269 critical splice donor site probably null
R5426:BC067074 UTSW 13 113369053 missense probably benign 0.01
R5472:BC067074 UTSW 13 113319169 missense probably benign 0.12
R5526:BC067074 UTSW 13 113367893 missense probably benign 0.22
R5543:BC067074 UTSW 13 113320873 missense probably damaging 0.96
R5589:BC067074 UTSW 13 113317950 missense possibly damaging 0.95
R5623:BC067074 UTSW 13 113346634 missense possibly damaging 0.95
R5668:BC067074 UTSW 13 113317167 missense possibly damaging 0.55
R5793:BC067074 UTSW 13 113321022 missense possibly damaging 0.75
R5824:BC067074 UTSW 13 113368620 missense probably damaging 1.00
R6038:BC067074 UTSW 13 113318619 missense possibly damaging 0.49
R6038:BC067074 UTSW 13 113318619 missense possibly damaging 0.49
R6053:BC067074 UTSW 13 113320726 missense possibly damaging 0.51
R6125:BC067074 UTSW 13 113317683 missense probably benign 0.00
R6129:BC067074 UTSW 13 113368806 nonsense probably null
R6290:BC067074 UTSW 13 113319958 missense probably damaging 0.97
R6291:BC067074 UTSW 13 113320447 missense possibly damaging 0.85
R6302:BC067074 UTSW 13 113368112 missense probably damaging 1.00
R6317:BC067074 UTSW 13 113368268 missense probably benign 0.09
R6395:BC067074 UTSW 13 113369469 missense probably damaging 1.00
R6673:BC067074 UTSW 13 113367832 nonsense probably null
R6783:BC067074 UTSW 13 113320209 nonsense probably null
R6800:BC067074 UTSW 13 113368152 missense probably benign 0.02
R6857:BC067074 UTSW 13 113319958 missense probably damaging 0.97
R6889:BC067074 UTSW 13 113318378 missense probably damaging 0.99
R6934:BC067074 UTSW 13 113369266 missense probably benign
R7019:BC067074 UTSW 13 113351750 missense probably benign 0.01
R7100:BC067074 UTSW 13 113318967 missense
R7115:BC067074 UTSW 13 113320776 missense
R7152:BC067074 UTSW 13 113318850 missense
R7195:BC067074 UTSW 13 113367929 missense
R7213:BC067074 UTSW 13 113317941 missense
R7250:BC067074 UTSW 13 113318815 missense
R7341:BC067074 UTSW 13 113318172 missense
R7358:BC067074 UTSW 13 113319967 missense
R7359:BC067074 UTSW 13 113342430 missense
R7396:BC067074 UTSW 13 113318990 missense
R7632:BC067074 UTSW 13 113320886 missense
R7689:BC067074 UTSW 13 113379414 missense
R7713:BC067074 UTSW 13 113346541 missense
R7892:BC067074 UTSW 13 113319606 missense
R7975:BC067074 UTSW 13 113319307 missense
R8017:BC067074 UTSW 13 113319623 missense
R8019:BC067074 UTSW 13 113319623 missense
R8101:BC067074 UTSW 13 113320891 missense
R8104:BC067074 UTSW 13 113319729 missense
R8122:BC067074 UTSW 13 113318908 missense
R8126:BC067074 UTSW 13 113368163 missense
R8272:BC067074 UTSW 13 113368355 missense
R8679:BC067074 UTSW 13 113351629 missense
R8973:BC067074 UTSW 13 113319759 missense
R9123:BC067074 UTSW 13 113368840 missense
R9125:BC067074 UTSW 13 113368840 missense
R9182:BC067074 UTSW 13 113320824 missense
R9233:BC067074 UTSW 13 113366220 missense
R9264:BC067074 UTSW 13 113319480 missense
R9306:BC067074 UTSW 13 113369476 missense unknown
R9327:BC067074 UTSW 13 113317176 missense
R9411:BC067074 UTSW 13 113368233 missense
R9516:BC067074 UTSW 13 113319115 missense
R9562:BC067074 UTSW 13 113368040 missense
R9605:BC067074 UTSW 13 113319969 missense
Predicted Primers PCR Primer
(F):5'- TCCTGATGATGAGGGTGGAC -3'
(R):5'- TTCATTGGCTCTCCGAAGC -3'

Sequencing Primer
(F):5'- GGACTGGAATTGGTTCTCTTCTC -3'
(R):5'- CATTGGCTCTCCGAAGCATGTTG -3'
Posted On 2020-01-23