Mutagenetix > Incidental Mutation

Incidental Mutation 'R8034:BC067074'

618145

Institutional Source

Beutler Lab

Gene Symbol

BC067074

Ensembl Gene

ENSMUSG00000021763

Gene Name

cDNA sequence BC067074

Synonyms

MMRRC Submission

Accession Numbers

Ncbi RefSeq: none; VEGA: OTTMUST00000084794; MGI:3040697

Is this an essential gene?

Possibly non essential (E-score: 0.278) question?

Stock #

R8034 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

113293159-113379711 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 113342511 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 1530 (I1530F)

Ref Sequence

ENSEMBL: ENSMUSP00000119993 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078163] [ENSMUST00000136755]

AlphaFold

F6RXI4

Predicted Effect

probably benign
Transcript: ENSMUST00000078163

SMART Domains

Protein: ENSMUSP00000077297
Gene: ENSMUSG00000021763

Domain	Start	End	E-Value	Type
Pfam:Cadherin_3	29	136	4.6e-12	PFAM
low complexity region	190	198	N/A	INTRINSIC
Pfam:Cadherin_3	231	384	4.9e-38	PFAM
transmembrane domain	725	747	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000119993
Gene: ENSMUSG00000021763
AA Change: I1530F

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
LamG	44	177	1.28e-20	SMART
LamG	229	371	4.66e-14	SMART
low complexity region	407	420	N/A	INTRINSIC
Pfam:Cadherin_3	492	644	2.1e-35	PFAM
Pfam:Cadherin_3	647	759	1e-7	PFAM
Pfam:Cadherin_3	741	873	1.2e-8	PFAM
Pfam:Cadherin_3	861	989	4.1e-14	PFAM
Pfam:Cadherin_3	958	1114	1.2e-20	PFAM
Pfam:Cadherin_3	1117	1223	1.6e-10	PFAM
Pfam:Cadherin_3	1212	1341	5.6e-12	PFAM
Pfam:Cadherin_3	1347	1438	3.8e-8	PFAM
Pfam:Cadherin_3	1419	1562	2.3e-45	PFAM
Pfam:Cadherin_3	1576	1679	2.1e-9	PFAM
low complexity region	1732	1740	N/A	INTRINSIC
Pfam:Cadherin_3	1773	1926	3e-35	PFAM
transmembrane domain	2267	2289	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap1	A	G	7: 101,394,773	T680A	probably damaging	Het
Asb3	C	A	11: 31,081,554	Y391*	probably null	Het
Bean1	CT	C	8: 104,182,032		probably null	Het
C130026I21Rik	T	A	1: 85,254,160	T180S	probably benign	Het
Ccdc80	A	G	16: 45,122,875	I783V	probably damaging	Het
Ccnf	A	G	17: 24,231,831	V391A	probably damaging	Het
Cd5l	C	A	3: 87,365,964	A80E	possibly damaging	Het
Chmp2b	A	T	16: 65,546,883	M96K	probably benign	Het
Dennd4a	T	C	9: 64,888,568	S725P	probably benign	Het
Dnah6	T	C	6: 73,129,225	N1843S	probably damaging	Het
Dpy19l3	A	G	7: 35,749,856	F41L	probably benign	Het
Eif3e	A	T	15: 43,272,307	M112K	probably benign	Het
Faim	T	C	9: 98,992,733	V111A	possibly damaging	Het
Fat1	A	G	8: 44,951,691	E493G	probably benign	Het
Fsip2	A	G	2: 82,989,355	D5144G	possibly damaging	Het
Fuz	T	C	7: 44,896,260	M1T	probably null	Het
Ggcx	T	C	6: 72,428,604	V529A	possibly damaging	Het
Gm7145	A	T	1: 117,986,164	T259S	probably benign	Het
Gria2	T	G	3: 80,801,699	T59P	probably damaging	Het
H2-Q10	A	T	17: 35,470,441	I47F	probably damaging	Het
Heatr6	A	G	11: 83,753,909	N63D	probably benign	Het
Ints7	CCGGATCG	CCGGATCGGATCG	1: 191,613,068		probably null	Het
Ints7	GATCG	GATCGTATCG	1: 191,613,071		probably null	Het
Lcn6	T	A	2: 25,676,871	L19*	probably null	Het
Lhcgr	T	C	17: 88,742,356	T581A	probably damaging	Het
Map4k1	T	C	7: 28,988,148	I203T	probably damaging	Het
Mctp1	G	C	13: 76,891,551	L783F	probably damaging	Het
Mlf1	A	T	3: 67,384,588	M29L	probably damaging	Het
Npas3	T	A	12: 53,640,529	I159N	probably damaging	Het
Nup98	T	C	7: 102,145,723		probably null	Het
Olfr1238	A	G	2: 89,406,737	V114A	probably benign	Het
Olfr1464-ps1	A	G	19: 13,282,851	F69S	probably damaging	Het
Olfr572	A	T	7: 102,928,566	K313*	probably null	Het
Olfr734	T	C	14: 50,320,566	K90E	probably damaging	Het
Olfr867	A	G	9: 20,055,005	F35L	probably benign	Het
Olfr890	T	C	9: 38,143,677	Y176H	probably damaging	Het
Otud3	T	C	4: 138,895,800	S377G	probably benign	Het
Pclo	T	A	5: 14,521,200	S200T	probably damaging	Het
Pex6	G	C	17: 46,722,399	G616A	possibly damaging	Het
Pkhd1	T	A	1: 20,381,438	H2211L	possibly damaging	Het
Sec13	T	C	6: 113,735,089	K95R	probably benign	Het
Sema3c	T	C	5: 17,727,482	V661A	probably damaging	Het
Sema5a	A	G	15: 32,574,841	Y365C	probably damaging	Het
Sprr2h	A	T	3: 92,386,813	E61V	unknown	Het
Tead3	A	C	17: 28,333,229	V365G	probably damaging	Het
Trpm7	T	A	2: 126,846,199	N236I	probably damaging	Het
Ubxn2b	A	G	4: 6,191,167	E13G	probably benign	Het
Zfp639	C	A	3: 32,520,066	A280E	probably damaging	Het

Other mutations in BC067074

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01723:BC067074	APN	13	113367557	missense	possibly damaging	0.91
IGL03023:BC067074	APN	13	113351741	missense	probably benign	0.03
cumpleanos	UTSW	13	113368336	missense	possibly damaging	0.87
Sorpresa	UTSW	13	113318191	missense	probably damaging	1.00
P0018:BC067074	UTSW	13	113367506	missense	possibly damaging	0.60
R0003:BC067074	UTSW	13	113368776	missense	probably benign	0.00
R0016:BC067074	UTSW	13	113366105	missense	probably damaging	1.00
R0016:BC067074	UTSW	13	113366105	missense	probably damaging	1.00
R0053:BC067074	UTSW	13	113368489	missense	probably benign	0.00
R0053:BC067074	UTSW	13	113368489	missense	probably benign	0.00
R0158:BC067074	UTSW	13	113369153	nonsense	probably null
R0281:BC067074	UTSW	13	113369143	missense	probably damaging	1.00
R1212:BC067074	UTSW	13	113369417	intron	probably benign
R1300:BC067074	UTSW	13	113366160	missense	probably damaging	1.00
R1434:BC067074	UTSW	13	113368492	missense	possibly damaging	0.46
R1509:BC067074	UTSW	13	113368256	missense	probably damaging	0.99
R1738:BC067074	UTSW	13	113367500	missense	possibly damaging	0.69
R1758:BC067074	UTSW	13	113368732	missense	possibly damaging	0.78
R1828:BC067074	UTSW	13	113368808	missense	probably damaging	1.00
R2061:BC067074	UTSW	13	113318094	missense	probably damaging	0.99
R2570:BC067074	UTSW	13	113318587	missense	probably benign	0.34
R2884:BC067074	UTSW	13	113320682	missense	probably damaging	1.00
R2884:BC067074	UTSW	13	113369191	missense	probably benign	0.00
R3004:BC067074	UTSW	13	113366154	missense	probably damaging	1.00
R3150:BC067074	UTSW	13	113351760	missense	probably damaging	1.00
R3773:BC067074	UTSW	13	113318209	missense	probably benign	0.12
R3864:BC067074	UTSW	13	113322951	missense	possibly damaging	0.64
R3971:BC067074	UTSW	13	113317126	missense	probably damaging	1.00
R4004:BC067074	UTSW	13	113318380	missense	probably benign	0.00
R4271:BC067074	UTSW	13	113342370	missense	possibly damaging	0.76
R4382:BC067074	UTSW	13	113322754	missense	probably benign	0.10
R4484:BC067074	UTSW	13	113319199	missense	probably damaging	0.98
R4570:BC067074	UTSW	13	113318191	missense	probably damaging	1.00
R4600:BC067074	UTSW	13	113319249	missense	possibly damaging	0.95
R4622:BC067074	UTSW	13	113320081	missense	probably benign	0.00
R4676:BC067074	UTSW	13	113368807	missense	probably damaging	0.98
R4676:BC067074	UTSW	13	113368808	missense	probably damaging	1.00
R4677:BC067074	UTSW	13	113379486	missense	unknown
R4775:BC067074	UTSW	13	113317695	missense	possibly damaging	0.91
R4779:BC067074	UTSW	13	113368336	missense	possibly damaging	0.87
R4780:BC067074	UTSW	13	113317858	missense	probably damaging	1.00
R4829:BC067074	UTSW	13	113368162	missense	probably benign	0.05
R4841:BC067074	UTSW	13	113366190	missense	probably benign	0.00
R4879:BC067074	UTSW	13	113319787	missense	probably benign	0.03
R4930:BC067074	UTSW	13	113327662	missense	probably damaging	1.00
R4934:BC067074	UTSW	13	113368348	missense	probably damaging	1.00
R4987:BC067074	UTSW	13	113318101	missense	probably benign	0.07
R5065:BC067074	UTSW	13	113320919	missense	probably benign	0.01
R5216:BC067074	UTSW	13	113342413	missense	probably benign	0.20
R5236:BC067074	UTSW	13	113366220	missense	probably benign	0.14
R5247:BC067074	UTSW	13	113319459	missense	probably damaging	1.00
R5250:BC067074	UTSW	13	113319771	missense	possibly damaging	0.95
R5337:BC067074	UTSW	13	113318765	missense	probably damaging	1.00
R5342:BC067074	UTSW	13	113366269	critical splice donor site	probably null
R5426:BC067074	UTSW	13	113369053	missense	probably benign	0.01
R5472:BC067074	UTSW	13	113319169	missense	probably benign	0.12
R5526:BC067074	UTSW	13	113367893	missense	probably benign	0.22
R5543:BC067074	UTSW	13	113320873	missense	probably damaging	0.96
R5589:BC067074	UTSW	13	113317950	missense	possibly damaging	0.95
R5623:BC067074	UTSW	13	113346634	missense	possibly damaging	0.95
R5668:BC067074	UTSW	13	113317167	missense	possibly damaging	0.55
R5793:BC067074	UTSW	13	113321022	missense	possibly damaging	0.75
R5824:BC067074	UTSW	13	113368620	missense	probably damaging	1.00
R6038:BC067074	UTSW	13	113318619	missense	possibly damaging	0.49
R6038:BC067074	UTSW	13	113318619	missense	possibly damaging	0.49
R6053:BC067074	UTSW	13	113320726	missense	possibly damaging	0.51
R6125:BC067074	UTSW	13	113317683	missense	probably benign	0.00
R6129:BC067074	UTSW	13	113368806	nonsense	probably null
R6290:BC067074	UTSW	13	113319958	missense	probably damaging	0.97
R6291:BC067074	UTSW	13	113320447	missense	possibly damaging	0.85
R6302:BC067074	UTSW	13	113368112	missense	probably damaging	1.00
R6317:BC067074	UTSW	13	113368268	missense	probably benign	0.09
R6395:BC067074	UTSW	13	113369469	missense	probably damaging	1.00
R6673:BC067074	UTSW	13	113367832	nonsense	probably null
R6783:BC067074	UTSW	13	113320209	nonsense	probably null
R6800:BC067074	UTSW	13	113368152	missense	probably benign	0.02
R6857:BC067074	UTSW	13	113319958	missense	probably damaging	0.97
R6889:BC067074	UTSW	13	113318378	missense	probably damaging	0.99
R6934:BC067074	UTSW	13	113369266	missense	probably benign
R7019:BC067074	UTSW	13	113351750	missense	probably benign	0.01
R7100:BC067074	UTSW	13	113318967	missense
R7115:BC067074	UTSW	13	113320776	missense
R7152:BC067074	UTSW	13	113318850	missense
R7195:BC067074	UTSW	13	113367929	missense
R7213:BC067074	UTSW	13	113317941	missense
R7250:BC067074	UTSW	13	113318815	missense
R7341:BC067074	UTSW	13	113318172	missense
R7358:BC067074	UTSW	13	113319967	missense
R7359:BC067074	UTSW	13	113342430	missense
R7396:BC067074	UTSW	13	113318990	missense
R7632:BC067074	UTSW	13	113320886	missense
R7689:BC067074	UTSW	13	113379414	missense
R7713:BC067074	UTSW	13	113346541	missense
R7892:BC067074	UTSW	13	113319606	missense
R7975:BC067074	UTSW	13	113319307	missense
R8017:BC067074	UTSW	13	113319623	missense
R8019:BC067074	UTSW	13	113319623	missense
R8101:BC067074	UTSW	13	113320891	missense
R8104:BC067074	UTSW	13	113319729	missense
R8122:BC067074	UTSW	13	113318908	missense
R8126:BC067074	UTSW	13	113368163	missense
R8272:BC067074	UTSW	13	113368355	missense
R8679:BC067074	UTSW	13	113351629	missense
R8973:BC067074	UTSW	13	113319759	missense
R9123:BC067074	UTSW	13	113368840	missense
R9125:BC067074	UTSW	13	113368840	missense
R9182:BC067074	UTSW	13	113320824	missense
R9233:BC067074	UTSW	13	113366220	missense
R9264:BC067074	UTSW	13	113319480	missense
R9306:BC067074	UTSW	13	113369476	missense	unknown
R9327:BC067074	UTSW	13	113317176	missense
R9411:BC067074	UTSW	13	113368233	missense
R9516:BC067074	UTSW	13	113319115	missense
R9562:BC067074	UTSW	13	113368040	missense
R9605:BC067074	UTSW	13	113319969	missense

Predicted Primers

PCR Primer
(F):5'- TCCTGATGATGAGGGTGGAC -3'
(R):5'- TTCATTGGCTCTCCGAAGC -3'

Sequencing Primer
(F):5'- GGACTGGAATTGGTTCTCTTCTC -3'
(R):5'- CATTGGCTCTCCGAAGCATGTTG -3'

Posted On

2020-01-23