Incidental Mutation 'R7053:Serpina1b'
ID547732
Institutional Source Beutler Lab
Gene Symbol Serpina1b
Ensembl Gene ENSMUSG00000071178
Gene Nameserine (or cysteine) preptidase inhibitor, clade A, member 1B
SynonymsPI2, D12Ucla2, Spi1-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R7053 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location103728156-103830373 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103732429 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 54 (S54C)
Ref Sequence ENSEMBL: ENSMUSP00000139941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095450] [ENSMUST00000164454] [ENSMUST00000186166] [ENSMUST00000187220]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095450
AA Change: S54C

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000093101
Gene: ENSMUSG00000071178
AA Change: S54C

DomainStartEndE-ValueType
SERPIN 53 410 7.62e-203 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000164454
AA Change: S54C

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127266
Gene: ENSMUSG00000071178
AA Change: S54C

DomainStartEndE-ValueType
SERPIN 53 410 7.62e-203 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000186166
AA Change: S54C

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139941
Gene: ENSMUSG00000071178
AA Change: S54C

DomainStartEndE-ValueType
SERPIN 53 410 7.62e-203 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187220
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Targeted disruption of this gene leads to significantly fewer than expected heterozygous and homozygous offspring from heterozygous matings. Homozygotes are healthy with no obvious changes in major organs while heterozygotes show a 30% decrease in serum anti-elastase and anti-chymotrypsin activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A T 8: 43,568,799 C551* probably null Het
Aldh1l1 C A 6: 90,563,438 T235K possibly damaging Het
Atp6v0a2 A G 5: 124,645,983 E257G probably damaging Het
AW146154 A G 7: 41,482,564 probably null Het
BC048507 T C 13: 67,863,653 Y50H probably benign Het
Brip1 T C 11: 86,192,965 N77D possibly damaging Het
Ccdc13 T C 9: 121,833,838 E37G probably damaging Het
Col27a1 T A 4: 63,333,167 probably benign Het
Corin T A 5: 72,301,527 I960L probably benign Het
Csnk2b A G 17: 35,116,446 probably benign Het
Cyp2d26 T C 15: 82,792,600 S182G probably benign Het
Dennd1a A G 2: 37,961,654 L74P probably damaging Het
Dip2c A G 13: 9,610,704 D838G probably damaging Het
Dkkl1 G T 7: 45,207,598 Q182K probably damaging Het
Dnaic2 T C 11: 114,738,695 S183P probably damaging Het
Dnhd1 T C 7: 105,694,954 L1835P probably damaging Het
Espl1 T C 15: 102,316,893 probably null Het
Fam160a2 C T 7: 105,384,572 G479D probably damaging Het
Fam174a C T 1: 95,325,228 A185V probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Grid2 G T 6: 64,700,418 A74S unknown Het
Gsdma3 T A 11: 98,629,795 M84K possibly damaging Het
Hlcs A T 16: 94,268,015 S262R possibly damaging Het
Lrp1 A G 10: 127,541,094 C4205R probably damaging Het
Mdc1 C T 17: 35,846,326 A181V probably benign Het
Mdga2 T A 12: 66,689,384 I357F probably benign Het
Mfn1 A G 3: 32,531,965 I21V probably benign Het
Mgat4b C T 11: 50,233,540 T409M probably damaging Het
Mgat4d G T 8: 83,371,632 K341N probably damaging Het
Mpo A T 11: 87,803,510 N109Y probably damaging Het
Mvp T C 7: 126,987,604 Q785R possibly damaging Het
Nim1k A G 13: 119,727,609 V88A probably damaging Het
Oasl2 A T 5: 114,911,230 I464L possibly damaging Het
Olfr1029 G T 2: 85,976,014 C257F possibly damaging Het
Pkd1l2 A G 8: 117,013,942 F2139L probably damaging Het
Pop1 T G 15: 34,530,275 S940A probably benign Het
Ppp1r9a T A 6: 4,905,670 M75K probably damaging Het
Prdm15 G A 16: 97,794,542 Q1029* probably null Het
Rffl T C 11: 82,812,671 K142R probably null Het
Rhou A G 8: 123,654,195 probably benign Het
Rp1l1 A T 14: 64,031,509 T1515S possibly damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Taok3 T A 5: 117,252,562 D529E probably benign Het
Tmem18 T A 12: 30,584,507 M1K probably null Het
Tmem269 T A 4: 119,209,267 H198L probably damaging Het
Tnrc18 A G 5: 142,787,229 V432A unknown Het
Ttc6 A T 12: 57,660,532 T742S probably benign Het
Uhrf2 T A 19: 30,092,119 C749S probably damaging Het
Unc13c G A 9: 73,932,297 T424I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r61 A C 7: 42,267,133 D390A probably damaging Het
Wisp3 A G 10: 39,158,301 Y102H probably damaging Het
Xpo7 A G 14: 70,684,858 probably null Het
Zfp948 T A 17: 21,584,859 L37* probably null Het
Other mutations in Serpina1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Serpina1b APN 12 103729296 missense possibly damaging 0.90
IGL00990:Serpina1b APN 12 103728266 missense probably damaging 1.00
IGL01947:Serpina1b APN 12 103729317 missense probably benign 0.00
IGL03258:Serpina1b APN 12 103730396 missense probably benign 0.00
IGL03392:Serpina1b APN 12 103732070 missense possibly damaging 0.53
R1937:Serpina1b UTSW 12 103732161 missense probably benign 0.00
R2383:Serpina1b UTSW 12 103728280 missense probably benign
R3789:Serpina1b UTSW 12 103729272 missense probably damaging 1.00
R4690:Serpina1b UTSW 12 103732380 missense probably damaging 1.00
R5164:Serpina1b UTSW 12 103732087 missense probably benign 0.01
R5650:Serpina1b UTSW 12 103728435 critical splice acceptor site probably null
R6017:Serpina1b UTSW 12 103729272 missense probably damaging 1.00
R6241:Serpina1b UTSW 12 103729256 unclassified probably null
R6522:Serpina1b UTSW 12 103735037 unclassified probably null
R6745:Serpina1b UTSW 12 103730355 missense possibly damaging 0.60
R6884:Serpina1b UTSW 12 103732453 missense probably benign 0.00
R7208:Serpina1b UTSW 12 103728294 missense probably benign 0.04
R7679:Serpina1b UTSW 12 103730515 missense probably damaging 1.00
R7908:Serpina1b UTSW 12 103728307 missense possibly damaging 0.65
R8056:Serpina1b UTSW 12 103817878 intron probably benign
Predicted Primers PCR Primer
(F):5'- ACTTGTGGATGTCAGCCTCC -3'
(R):5'- GTGGTAGCTGATAGGAGTCACC -3'

Sequencing Primer
(F):5'- ATGTCAGCCTCCGATGTTTG -3'
(R):5'- GCTGATAGGAGTCACCACAGC -3'
Posted On2019-05-13