Incidental Mutation 'R7081:Arhgef10'
ID549533
Institutional Source Beutler Lab
Gene Symbol Arhgef10
Ensembl Gene ENSMUSG00000071176
Gene NameRho guanine nucleotide exchange factor (GEF) 10
Synonyms6430549H08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7081 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location14911663-15001085 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 14997547 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 1137 (Q1137*)
Ref Sequence ENSEMBL: ENSMUSP00000081225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084207] [ENSMUST00000110800] [ENSMUST00000163062]
Predicted Effect probably null
Transcript: ENSMUST00000084207
AA Change: Q1137*
SMART Domains Protein: ENSMUSP00000081225
Gene: ENSMUSG00000071176
AA Change: Q1137*

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 236 245 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
coiled coil region 308 335 N/A INTRINSIC
RhoGEF 401 583 9.79e-58 SMART
Blast:PH 617 829 6e-47 BLAST
low complexity region 1256 1272 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110800
AA Change: Q1098*
SMART Domains Protein: ENSMUSP00000106424
Gene: ENSMUSG00000071176
AA Change: Q1098*

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 236 245 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
low complexity region 280 291 N/A INTRINSIC
RhoGEF 362 544 9.79e-58 SMART
Blast:PH 578 790 8e-47 BLAST
low complexity region 1217 1233 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163062
AA Change: Q780*
SMART Domains Protein: ENSMUSP00000125526
Gene: ENSMUSG00000071176
AA Change: Q780*

DomainStartEndE-ValueType
RhoGEF 73 255 9.79e-58 SMART
Blast:PH 289 501 2e-47 BLAST
low complexity region 899 915 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Rho guanine nucleotide exchange factor (GEF). Rho GEFs regulate the activity of small Rho GTPases by stimulating the exchange of guanine diphosphate (GDP) for guanine triphosphate (GTP) and may play a role in neural morphogenesis. Mutations in this gene are associated with slowed nerve conduction velocity (SNCV). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A G 6: 96,165,817 V82A possibly damaging Het
Aatf T A 11: 84,471,125 H337L possibly damaging Het
Abcb4 T A 5: 8,934,263 N664K probably benign Het
Adh7 A G 3: 138,228,845 D343G probably benign Het
Als2cl G A 9: 110,894,582 R682Q possibly damaging Het
Angptl6 A C 9: 20,875,348 I334R probably damaging Het
Ankrd45 A G 1: 161,151,293 N101D probably benign Het
Asap3 T A 4: 136,241,570 probably null Het
Bmp2k T C 5: 97,064,961 S568P unknown Het
C4b A C 17: 34,735,443 F917L probably benign Het
Cacna1e A T 1: 154,700,383 V168E possibly damaging Het
Ccdc60 T A 5: 116,126,087 I543F probably benign Het
Cd36 T C 5: 17,814,704 D133G probably damaging Het
Chd4 T C 6: 125,129,985 V1911A unknown Het
Cplx4 A T 18: 65,967,467 probably null Het
Cyp1a2 A T 9: 57,678,989 D415E possibly damaging Het
Cyp3a57 T C 5: 145,381,373 I388T probably damaging Het
Dnajc5b T C 3: 19,546,861 probably null Het
Dock4 A T 12: 40,621,286 I35F probably damaging Het
Efna4 A T 3: 89,334,294 L206Q unknown Het
Eif2a T C 3: 58,541,718 probably null Het
Fam120a A G 13: 48,910,325 F612L probably damaging Het
Fbxw21 A G 9: 109,161,922 L23P probably damaging Het
Fcamr A T 1: 130,813,212 E456V probably damaging Het
Fkbp8 G A 8: 70,530,994 R106H probably benign Het
Galr2 T A 11: 116,283,048 L168Q probably damaging Het
Gm11111 C T 5: 98,553,540 S22L unknown Het
Gm14124 A G 2: 150,268,269 H293R possibly damaging Het
Gm3183 T A 5: 94,874,782 N107K possibly damaging Het
Gnpat T C 8: 124,863,269 F11S possibly damaging Het
H2-T24 A T 17: 36,017,452 D46E probably damaging Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Ifna12 T C 4: 88,603,203 R36G probably damaging Het
Kcnma1 G A 14: 23,300,018 P1151L probably damaging Het
Kif5c T A 2: 49,741,361 D683E probably benign Het
Krit1 T C 5: 3,823,651 Y477H possibly damaging Het
Lipm T A 19: 34,121,323 V399D possibly damaging Het
Lrguk A T 6: 34,102,139 T770S probably benign Het
Lrrc37a T C 11: 103,457,955 N2638S unknown Het
Lrrc40 T C 3: 158,036,805 V27A probably damaging Het
Map4k1 T C 7: 28,991,149 V355A probably benign Het
Mylk3 T C 8: 85,364,793 I128V probably benign Het
Myo1c A G 11: 75,660,963 D289G probably benign Het
Mypn A G 10: 63,134,958 F889S probably damaging Het
Ndufv3 C T 17: 31,527,433 P99L possibly damaging Het
Nlrp10 A C 7: 108,924,648 S542A probably benign Het
Noc2l T A 4: 156,247,020 D718E possibly damaging Het
Ntng1 T A 3: 109,851,789 I355F probably benign Het
Nup210 A G 6: 91,060,665 V742A possibly damaging Het
Olfr1037 A T 2: 86,085,595 F61I probably damaging Het
Olfr560 A T 7: 102,753,188 I247N probably benign Het
Olig2 T A 16: 91,226,419 L7Q probably damaging Het
Parpbp A T 10: 88,093,655 W444R probably damaging Het
Plekhg3 A G 12: 76,578,245 E1287G probably benign Het
Pramef25 T C 4: 143,949,278 D326G probably damaging Het
Prrc2b A T 2: 32,213,063 Q851L probably benign Het
Psg21 C T 7: 18,654,849 W106* probably null Het
Rab18 T G 18: 6,778,529 D53E probably benign Het
Rbm19 T A 5: 120,123,151 probably null Het
Rhobtb1 T C 10: 69,266,297 V136A probably benign Het
Rsph4a G A 10: 33,909,193 V367I probably damaging Het
Sec24b T C 3: 129,987,742 N1161S probably benign Het
Sgcd C A 11: 47,125,601 G145* probably null Het
Sin3a A G 9: 57,094,471 K134R probably null Het
Slc9b2 A G 3: 135,321,937 E108G probably benign Het
Stk24 A T 14: 121,294,294 S317T probably benign Het
Stra8 T A 6: 34,934,367 probably null Het
Tmem131 A G 1: 36,889,295 V71A possibly damaging Het
Tmem87a T C 2: 120,380,783 D227G possibly damaging Het
Vnn1 T A 10: 23,895,005 L44M possibly damaging Het
Wdr20 G A 12: 110,803,450 V160I possibly damaging Het
Zfand4 T A 6: 116,315,620 N667K possibly damaging Het
Zfp609 A G 9: 65,702,441 V1080A possibly damaging Het
Zhx1 C T 15: 58,054,338 V171I probably benign Het
Other mutations in Arhgef10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Arhgef10 APN 8 14975006 missense probably damaging 1.00
IGL00823:Arhgef10 APN 8 14940378 unclassified probably benign
IGL01012:Arhgef10 APN 8 14979977 missense probably damaging 0.99
IGL01311:Arhgef10 APN 8 14991054 splice site probably null
IGL01596:Arhgef10 APN 8 14999468 nonsense probably null
IGL01888:Arhgef10 APN 8 14962577 nonsense probably null
IGL01938:Arhgef10 APN 8 14991062 missense probably benign 0.09
IGL02151:Arhgef10 APN 8 14928889 missense possibly damaging 0.77
IGL02274:Arhgef10 APN 8 14947205 missense probably damaging 0.99
IGL02369:Arhgef10 APN 8 14997551 missense probably damaging 1.00
IGL02411:Arhgef10 APN 8 14954819 missense probably benign 0.01
IGL02500:Arhgef10 APN 8 14961238 missense probably damaging 1.00
IGL02597:Arhgef10 APN 8 14930198 missense probably benign 0.27
IGL02602:Arhgef10 APN 8 14930198 missense probably benign 0.27
IGL02743:Arhgef10 APN 8 14930198 missense probably benign 0.27
IGL02744:Arhgef10 APN 8 14930198 missense probably benign 0.27
IGL03113:Arhgef10 APN 8 14954505 missense probably damaging 1.00
IGL03248:Arhgef10 APN 8 14928847 missense probably benign 0.00
P0028:Arhgef10 UTSW 8 14928925 missense possibly damaging 0.79
P4748:Arhgef10 UTSW 8 14928925 missense possibly damaging 0.79
R0049:Arhgef10 UTSW 8 14954446 missense probably damaging 1.00
R0197:Arhgef10 UTSW 8 14962636 missense probably damaging 1.00
R0479:Arhgef10 UTSW 8 14991070 missense probably damaging 0.98
R0701:Arhgef10 UTSW 8 14962636 missense probably damaging 1.00
R0966:Arhgef10 UTSW 8 14940343 missense probably benign 0.01
R1367:Arhgef10 UTSW 8 14940225 missense probably damaging 1.00
R1572:Arhgef10 UTSW 8 14991211 missense possibly damaging 0.53
R1631:Arhgef10 UTSW 8 14947157 missense probably damaging 0.98
R1766:Arhgef10 UTSW 8 14979836 missense probably damaging 1.00
R1920:Arhgef10 UTSW 8 14956987 splice site probably benign
R2051:Arhgef10 UTSW 8 14945320 missense probably null 1.00
R2088:Arhgef10 UTSW 8 14983898 missense possibly damaging 0.46
R2118:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2120:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2121:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2122:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2124:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2318:Arhgef10 UTSW 8 14928855 missense probably damaging 1.00
R2870:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2870:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R2870:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2870:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R2872:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2872:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R2872:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2872:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R2874:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2874:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R3522:Arhgef10 UTSW 8 14954918 missense probably damaging 1.00
R4049:Arhgef10 UTSW 8 14979998 missense probably benign 0.05
R4324:Arhgef10 UTSW 8 14940335 missense possibly damaging 0.77
R4351:Arhgef10 UTSW 8 14991145 nonsense probably null
R4384:Arhgef10 UTSW 8 14930157 nonsense probably null
R4385:Arhgef10 UTSW 8 14930157 nonsense probably null
R4685:Arhgef10 UTSW 8 14956963 missense probably damaging 1.00
R5111:Arhgef10 UTSW 8 14932408 missense probably benign 0.00
R5169:Arhgef10 UTSW 8 14930051 missense possibly damaging 0.80
R5670:Arhgef10 UTSW 8 14954774 missense probably benign 0.01
R5945:Arhgef10 UTSW 8 14980028 critical splice donor site probably null
R6593:Arhgef10 UTSW 8 14962522 missense probably damaging 1.00
R6593:Arhgef10 UTSW 8 14962564 missense possibly damaging 0.82
R6734:Arhgef10 UTSW 8 14975053 missense probably damaging 1.00
R6859:Arhgef10 UTSW 8 14975005 missense probably damaging 1.00
R6890:Arhgef10 UTSW 8 14928786 missense probably benign 0.27
R7068:Arhgef10 UTSW 8 14958639 missense probably damaging 1.00
R7157:Arhgef10 UTSW 8 14930030 missense probably damaging 1.00
R7232:Arhgef10 UTSW 8 14940323 missense probably benign 0.10
R7514:Arhgef10 UTSW 8 14975956 missense probably benign 0.16
R7544:Arhgef10 UTSW 8 14979854 missense probably benign 0.34
R7657:Arhgef10 UTSW 8 14979893 missense probably damaging 1.00
R7736:Arhgef10 UTSW 8 14980583 nonsense probably null
R7777:Arhgef10 UTSW 8 14945373 missense probably damaging 1.00
R8000:Arhgef10 UTSW 8 14930054 missense probably damaging 1.00
R8060:Arhgef10 UTSW 8 14954446 missense probably damaging 1.00
R8441:Arhgef10 UTSW 8 14991237 splice site probably benign
R8545:Arhgef10 UTSW 8 14928868 missense probably benign 0.00
R8545:Arhgef10 UTSW 8 14975931 missense possibly damaging 0.83
R8702:Arhgef10 UTSW 8 14942638 missense probably benign
R8846:Arhgef10 UTSW 8 14975956 missense probably benign 0.16
R8854:Arhgef10 UTSW 8 14979798 critical splice acceptor site probably null
X0024:Arhgef10 UTSW 8 14978486 missense probably benign 0.01
X0027:Arhgef10 UTSW 8 14997631 missense possibly damaging 0.92
Z1088:Arhgef10 UTSW 8 14964191 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGTGTGAGCATCCTAACAGC -3'
(R):5'- GAGCAAGTTATGTCTCTGCTAAG -3'

Sequencing Primer
(F):5'- GTGTGAGCATCCTAACAGCTTACC -3'
(R):5'- CCTACAGTTCTCTAAAGATGACAGG -3'
Posted On2019-05-15