Mutagenetix > Incidental Mutations

Incidental Mutation 'R7086:Rapgef2'

549885

Institutional Source

Beutler Lab

Gene Symbol

Rapgef2

Ensembl Gene

ENSMUSG00000062232

Gene Name

Rap guanine nucleotide exchange factor (GEF) 2

Synonyms

CNRasGEF, RA-GEF-1, Pdzgef1, nRapGEP, 5830453M24Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7086 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

79062516-79286517 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 79086046 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 712 (S712P)

Ref Sequence

ENSEMBL: ENSMUSP00000114119 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000118100] [ENSMUST00000118340] [ENSMUST00000195708]

Predicted Effect

probably benign
Transcript: ENSMUST00000118100
AA Change: S712P

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000114119
Gene: ENSMUSG00000062232
AA Change: S712P

Domain	Start	End	E-Value	Type
low complexity region	38	62	N/A	INTRINSIC
low complexity region	84	95	N/A	INTRINSIC
cNMP	135	253	2.48e-15	SMART
RasGEFN	267	380	1.3e-31	SMART
PDZ	395	467	1.28e-12	SMART
RA	606	692	7.59e-23	SMART
RasGEF	713	950	6.09e-100	SMART
low complexity region	1030	1046	N/A	INTRINSIC
low complexity region	1110	1124	N/A	INTRINSIC
low complexity region	1140	1161	N/A	INTRINSIC
low complexity region	1392	1405	N/A	INTRINSIC
low complexity region	1440	1455	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000118340
AA Change: S710P

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000113778
Gene: ENSMUSG00000062232
AA Change: S710P

Domain	Start	End	E-Value	Type
low complexity region	36	60	N/A	INTRINSIC
low complexity region	82	93	N/A	INTRINSIC
cNMP	133	251	2.48e-15	SMART
RasGEFN	265	378	1.3e-31	SMART
PDZ	393	465	1.28e-12	SMART
RA	604	690	7.59e-23	SMART
RasGEF	711	948	6.09e-100	SMART
low complexity region	1028	1044	N/A	INTRINSIC
low complexity region	1108	1122	N/A	INTRINSIC
low complexity region	1138	1159	N/A	INTRINSIC
low complexity region	1390	1403	N/A	INTRINSIC
low complexity region	1438	1453	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000195708
AA Change: S860P

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000141542
Gene: ENSMUSG00000062232
AA Change: S860P

Domain	Start	End	E-Value	Type
cNMP	24	131	3.9e-4	SMART
low complexity region	186	210	N/A	INTRINSIC
low complexity region	232	243	N/A	INTRINSIC
cNMP	283	401	1.2e-17	SMART
RasGEFN	415	528	6.4e-34	SMART
PDZ	543	615	6.4e-15	SMART
RA	754	840	4.8e-25	SMART
RasGEF	861	1098	3.8e-102	SMART
low complexity region	1178	1194	N/A	INTRINSIC
low complexity region	1258	1272	N/A	INTRINSIC
low complexity region	1288	1309	N/A	INTRINSIC
low complexity region	1540	1553	N/A	INTRINSIC
low complexity region	1588	1603	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (60/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the RAS (see HRAS; MIM 190020) subfamily of GTPases function in signal transduction as GTP/GDP-regulated switches that cycle between inactive GDP- and active GTP-bound states. Guanine nucleotide exchange factors (GEFs), such as RAPGEF2, serve as RAS activators by promoting acquisition of GTP to maintain the active GTP-bound state and are the key link between cell surface receptors and RAS activation (Rebhun et al., 2000 [PubMed 10934204]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a null allele die at mid-gestation exhibiting growth arrest and defects in vascular development, neural tube closure and embryo turning. Homozygotes for another null allele show yolk sac vascular defects, impaired cell physiology and heart, primitive gut, liver and brain formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam30	A	G	3: 98,161,319	H28R	probably damaging	Het
Adgre4	T	C	17: 55,820,649	I563T	probably benign	Het
Ankub1	A	T	3: 57,690,325	C75S	probably damaging	Het
Antxrl	G	A	14: 34,065,916	V299I	probably benign	Het
Arfgef2	T	A	2: 166,876,616	C1442S	probably damaging	Het
Atp13a3	T	C	16: 30,351,063	D399G	possibly damaging	Het
Cacna2d1	T	A	5: 16,349,416	Y666N	probably damaging	Het
Cenpo	C	T	12: 4,215,307	E238K	probably benign	Het
Chrng	C	A	1: 87,211,013	R455S	probably benign	Het
Cluh	T	A	11: 74,667,340	H1155Q	possibly damaging	Het
Col16a1	G	A	4: 130,052,980		probably null	Het
Cpne5	G	A	17: 29,159,077	P576L	unknown	Het
Crocc	C	A	4: 141,047,057	V144L	possibly damaging	Het
Cubn	A	G	2: 13,319,858	V2781A	probably damaging	Het
Cyp8b1	A	G	9: 121,915,289	F326L	probably benign	Het
Dclk1	G	A	3: 55,487,912		probably null	Het
Dnah7c	A	G	1: 46,750,125	R3303G	probably benign	Het
Dnhd1	G	T	7: 105,708,532	R3191S	probably benign	Het
Fgfbp3	T	G	19: 36,918,703	S172R	possibly damaging	Het
Gpr158	G	A	2: 21,826,575	V829I	probably benign	Het
Gtse1	A	G	15: 85,875,549	D647G	probably damaging	Het
H2-Q7	T	A	17: 35,439,485	V33E	probably damaging	Het
Hydin	A	G	8: 110,600,245	T4739A	possibly damaging	Het
Kcnip1	G	T	11: 33,634,629	P175T	probably damaging	Het
Klhl10	T	C	11: 100,456,942	V608A	probably benign	Het
Klhl2	A	G	8: 64,823,012	Y80H	probably damaging	Het
Lnx2	A	T	5: 147,020,178		probably null	Het
Lst1	G	A	17: 35,185,286	H59Y	probably damaging	Het
Maats1	A	T	16: 38,306,857	F512L	possibly damaging	Het
Mphosph8	G	C	14: 56,668,523	V58L	possibly damaging	Het
Mpnd	C	A	17: 56,009,457	S45R	possibly damaging	Het
Myh8	A	G	11: 67,292,627		probably null	Het
Odf3	A	G	7: 140,849,489	H151R	probably benign	Het
Olfr1263	A	G	2: 90,015,250	I107V	probably benign	Het
Olfr533	A	G	7: 140,466,428	T76A	possibly damaging	Het
Phox2a	A	G	7: 101,818,511	Y5C	probably damaging	Het
Pkdrej	A	G	15: 85,820,116	S540P	probably damaging	Het
Plcb4	A	G	2: 136,007,847	M1133V	probably benign	Het
Plxnc1	T	C	10: 94,831,435	M1126V	probably benign	Het
Ppm1l	A	G	3: 69,317,853	Y96C	probably damaging	Het
Prpsap1	T	C	11: 116,477,283	T234A	probably benign	Het
R3hcc1l	T	C	19: 42,581,970	V668A	probably damaging	Het
Rcc2	T	C	4: 140,707,969	C100R	probably benign	Het
Recql4	C	A	15: 76,705,553	G764V	unknown	Het
Rlbp1	A	G	7: 79,380,065	I140T	possibly damaging	Het
Samsn1	T	C	16: 75,870,906	T261A	probably benign	Het
Sgtb	T	C	13: 104,118,416	S65P	possibly damaging	Het
Spag9	T	C	11: 94,097,864	V920A	probably benign	Het
Spata31	T	A	13: 64,922,229	S730R	probably benign	Het
Spta1	C	T	1: 174,199,484	A841V	probably damaging	Het
St5	A	G	7: 109,525,574	I1083T	probably damaging	Het
Tnfaip1	T	C	11: 78,525,439	S273G	probably benign	Het
Vezf1	T	C	11: 88,078,538	V371A	probably benign	Het
Vmn1r67	G	A	7: 10,447,117	V103I	possibly damaging	Het
Vmn2r87	G	T	10: 130,497,309	T24K	probably benign	Het
Wdr43	G	A	17: 71,616,439	G60D	probably benign	Het
Xkr4	G	A	1: 3,216,962	T335I	probably damaging	Het
Zdhhc23	A	T	16: 43,971,510	I300N	probably damaging	Het
Zfp729b	T	C	13: 67,592,937	K403R	probably damaging	Het

Other mutations in Rapgef2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00488:Rapgef2	APN	3	79092025	missense	possibly damaging	0.89
IGL01024:Rapgef2	APN	3	79070138	missense	probably benign	0.43
IGL01448:Rapgef2	APN	3	79068937	missense	probably benign
IGL01448:Rapgef2	APN	3	79103962	critical splice donor site	probably null
IGL01928:Rapgef2	APN	3	79103963	missense	probably damaging	1.00
IGL01973:Rapgef2	APN	3	79091809	splice site	probably null
IGL02015:Rapgef2	APN	3	79092064	splice site	probably benign
IGL02498:Rapgef2	APN	3	79066753	missense	probably damaging	0.97
IGL02631:Rapgef2	APN	3	79083226	missense	possibly damaging	0.77
IGL02835:Rapgef2	APN	3	79092986	splice site	probably benign
IGL02887:Rapgef2	APN	3	79068880	splice site	probably benign
IGL03030:Rapgef2	APN	3	79074307	critical splice donor site	probably null
IGL03035:Rapgef2	APN	3	79094424	missense	probably damaging	1.00
IGL03222:Rapgef2	APN	3	79087995	missense	probably damaging	1.00
IGL03227:Rapgef2	APN	3	79092613	splice site	probably benign
IGL03326:Rapgef2	APN	3	79091833	missense	probably damaging	0.96
IGL03335:Rapgef2	APN	3	79099185	missense	probably damaging	1.00
IGL03384:Rapgef2	APN	3	79083546	missense	probably damaging	1.00
R0022:Rapgef2	UTSW	3	79087900	missense	probably damaging	1.00
R0022:Rapgef2	UTSW	3	79087900	missense	probably damaging	1.00
R0038:Rapgef2	UTSW	3	79069396	missense	probably benign	0.00
R0117:Rapgef2	UTSW	3	79079177	missense	probably benign	0.00
R0225:Rapgef2	UTSW	3	79104105	missense	probably damaging	0.99
R0723:Rapgef2	UTSW	3	79079174	missense	probably benign	0.20
R0788:Rapgef2	UTSW	3	79099195	missense	possibly damaging	0.59
R1311:Rapgef2	UTSW	3	79083547	missense	probably benign	0.12
R1374:Rapgef2	UTSW	3	79087968	missense	probably benign	0.08
R1507:Rapgef2	UTSW	3	79081293	splice site	probably benign
R1523:Rapgef2	UTSW	3	79092749	missense	probably damaging	1.00
R1753:Rapgef2	UTSW	3	79088791	missense	possibly damaging	0.65
R1759:Rapgef2	UTSW	3	79066731	missense	possibly damaging	0.89
R1766:Rapgef2	UTSW	3	79092703	missense	probably damaging	1.00
R2436:Rapgef2	UTSW	3	79088772	missense	possibly damaging	0.95
R3033:Rapgef2	UTSW	3	79074306	critical splice donor site	probably null
R3766:Rapgef2	UTSW	3	79088750	missense	probably benign	0.01
R4118:Rapgef2	UTSW	3	79068887	critical splice donor site	probably null
R4416:Rapgef2	UTSW	3	79069057	nonsense	probably null
R4722:Rapgef2	UTSW	3	79069173	missense	probably benign	0.00
R4743:Rapgef2	UTSW	3	79173068	missense	probably damaging	0.99
R4780:Rapgef2	UTSW	3	79169769	splice site	probably benign
R4825:Rapgef2	UTSW	3	79083227	missense	probably benign	0.03
R4861:Rapgef2	UTSW	3	79074436	missense	probably benign	0.01
R4861:Rapgef2	UTSW	3	79074436	missense	probably benign	0.01
R4900:Rapgef2	UTSW	3	79074363	missense	probably benign	0.02
R4943:Rapgef2	UTSW	3	79064547	missense	probably benign	0.00
R5291:Rapgef2	UTSW	3	79070059	missense	possibly damaging	0.64
R5369:Rapgef2	UTSW	3	79069432	missense	probably benign	0.00
R5413:Rapgef2	UTSW	3	79087866	missense	probably damaging	1.00
R5561:Rapgef2	UTSW	3	79088643	critical splice donor site	probably null
R5568:Rapgef2	UTSW	3	79104001	missense	probably damaging	1.00
R5642:Rapgef2	UTSW	3	79094850	missense	probably damaging	1.00
R5783:Rapgef2	UTSW	3	79087993	missense	probably benign	0.00
R6041:Rapgef2	UTSW	3	79069162	missense	probably benign	0.00
R6193:Rapgef2	UTSW	3	79069444	missense	possibly damaging	0.48
R6324:Rapgef2	UTSW	3	79079132	missense	probably benign	0.01
R6551:Rapgef2	UTSW	3	79215035	splice site	probably null
R6688:Rapgef2	UTSW	3	79069128	missense	probably benign	0.03
R6908:Rapgef2	UTSW	3	79104063	missense	probably benign	0.01
R6913:Rapgef2	UTSW	3	79085974	missense	probably damaging	1.00
R6933:Rapgef2	UTSW	3	79085959	missense	probably damaging	1.00
R7106:Rapgef2	UTSW	3	79066608	missense	probably benign
R7228:Rapgef2	UTSW	3	79069218	missense	probably benign	0.03
R7242:Rapgef2	UTSW	3	79087903	nonsense	probably null
R7257:Rapgef2	UTSW	3	79082627	missense	probably damaging	0.99
R7322:Rapgef2	UTSW	3	79145823	start codon destroyed	probably null	0.02
R7443:Rapgef2	UTSW	3	79081224	missense	probably damaging	1.00
R7450:Rapgef2	UTSW	3	79173059	missense	probably benign	0.01
R7472:Rapgef2	UTSW	3	79069273	missense	probably benign	0.45

Predicted Primers

PCR Primer
(F):5'- AGCCACCCAAAATGTTTCCTGG -3'
(R):5'- TGCCCGTGATGGATGAAAAG -3'

Sequencing Primer
(F):5'- CCACCCAAAATGTTTCCTGGTTAATG -3'
(R):5'- CCGTGATGGATGAAAAGAACTCTTAC -3'

Posted On

2019-05-15