Incidental Mutation 'R6913:Rapgef2'
ID539152
Institutional Source Beutler Lab
Gene Symbol Rapgef2
Ensembl Gene ENSMUSG00000062232
Gene NameRap guanine nucleotide exchange factor (GEF) 2
SynonymsCNRasGEF, RA-GEF-1, Pdzgef1, nRapGEP, 5830453M24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6913 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location79062516-79286517 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79085974 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 884 (I884F)
Ref Sequence ENSEMBL: ENSMUSP00000141542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118100] [ENSMUST00000118340] [ENSMUST00000195708]
Predicted Effect probably damaging
Transcript: ENSMUST00000118100
AA Change: I736F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114119
Gene: ENSMUSG00000062232
AA Change: I736F

DomainStartEndE-ValueType
low complexity region 38 62 N/A INTRINSIC
low complexity region 84 95 N/A INTRINSIC
cNMP 135 253 2.48e-15 SMART
RasGEFN 267 380 1.3e-31 SMART
PDZ 395 467 1.28e-12 SMART
RA 606 692 7.59e-23 SMART
RasGEF 713 950 6.09e-100 SMART
low complexity region 1030 1046 N/A INTRINSIC
low complexity region 1110 1124 N/A INTRINSIC
low complexity region 1140 1161 N/A INTRINSIC
low complexity region 1392 1405 N/A INTRINSIC
low complexity region 1440 1455 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118340
AA Change: I734F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113778
Gene: ENSMUSG00000062232
AA Change: I734F

DomainStartEndE-ValueType
low complexity region 36 60 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
cNMP 133 251 2.48e-15 SMART
RasGEFN 265 378 1.3e-31 SMART
PDZ 393 465 1.28e-12 SMART
RA 604 690 7.59e-23 SMART
RasGEF 711 948 6.09e-100 SMART
low complexity region 1028 1044 N/A INTRINSIC
low complexity region 1108 1122 N/A INTRINSIC
low complexity region 1138 1159 N/A INTRINSIC
low complexity region 1390 1403 N/A INTRINSIC
low complexity region 1438 1453 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195708
AA Change: I884F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141542
Gene: ENSMUSG00000062232
AA Change: I884F

DomainStartEndE-ValueType
cNMP 24 131 3.9e-4 SMART
low complexity region 186 210 N/A INTRINSIC
low complexity region 232 243 N/A INTRINSIC
cNMP 283 401 1.2e-17 SMART
RasGEFN 415 528 6.4e-34 SMART
PDZ 543 615 6.4e-15 SMART
RA 754 840 4.8e-25 SMART
RasGEF 861 1098 3.8e-102 SMART
low complexity region 1178 1194 N/A INTRINSIC
low complexity region 1258 1272 N/A INTRINSIC
low complexity region 1288 1309 N/A INTRINSIC
low complexity region 1540 1553 N/A INTRINSIC
low complexity region 1588 1603 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.9%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the RAS (see HRAS; MIM 190020) subfamily of GTPases function in signal transduction as GTP/GDP-regulated switches that cycle between inactive GDP- and active GTP-bound states. Guanine nucleotide exchange factors (GEFs), such as RAPGEF2, serve as RAS activators by promoting acquisition of GTP to maintain the active GTP-bound state and are the key link between cell surface receptors and RAS activation (Rebhun et al., 2000 [PubMed 10934204]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a null allele die at mid-gestation exhibiting growth arrest and defects in vascular development, neural tube closure and embryo turning. Homozygotes for another null allele show yolk sac vascular defects, impaired cell physiology and heart, primitive gut, liver and brain formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A T 16: 20,378,744 I619N possibly damaging Het
Accsl T C 2: 93,866,143 K41E possibly damaging Het
Actr6 T C 10: 89,726,696 E107G probably damaging Het
Adam7 T A 14: 68,533,651 M9L probably benign Het
Adamts12 T A 15: 11,215,692 H266Q probably damaging Het
Adamts16 A G 13: 70,728,898 F1208S possibly damaging Het
Ankrd11 T C 8: 122,894,911 D734G probably benign Het
Ap1b1 T C 11: 5,012,972 V43A possibly damaging Het
Asnsd1 A G 1: 53,348,231 V79A probably damaging Het
Aste1 T A 9: 105,397,408 S221R probably benign Het
Ccndbp1 G A 2: 121,009,866 E94K probably benign Het
Cdc34 G A 10: 79,685,103 probably null Het
Cdh16 T C 8: 104,622,264 D67G probably benign Het
Chd8 T C 14: 52,214,494 E1348G probably damaging Het
Chl1 C T 6: 103,665,948 Q216* probably null Het
Cse1l G A 2: 166,929,877 V353I possibly damaging Het
Ctbp2 G A 7: 133,014,726 S160F possibly damaging Het
Cyp1a1 C A 9: 57,700,293 T68K probably damaging Het
Dlgap2 T A 8: 14,778,374 M594K probably benign Het
Dnah6 C T 6: 73,212,522 E48K probably benign Het
Dock2 A G 11: 34,756,222 V35A probably damaging Het
E330009J07Rik T C 6: 40,406,917 N397S possibly damaging Het
Edem2 A T 2: 155,726,674 S73R probably damaging Het
Eps15 T C 4: 109,361,230 V430A probably benign Het
Frem2 T C 3: 53,516,821 N3065S probably damaging Het
Gal3st4 A T 5: 138,270,828 S123R possibly damaging Het
Garnl3 T A 2: 32,986,829 I937F possibly damaging Het
Gfod2 C T 8: 105,717,363 V183M possibly damaging Het
Glipr1l1 T C 10: 112,062,434 probably null Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gm7145 T G 1: 117,985,981 C198G probably damaging Het
Gm906 G T 13: 50,245,257 P1011H probably damaging Het
H2-Eb2 G A 17: 34,333,549 A123T possibly damaging Het
Ighv1-55 T C 12: 115,208,509 I7V probably benign Het
Itpripl2 G T 7: 118,491,109 P76T possibly damaging Het
Kat6a C A 8: 22,903,199 A231E possibly damaging Het
Lipo1 C T 19: 33,780,305 V255I probably benign Het
Mamstr A T 7: 45,643,238 M141L probably benign Het
Med13 A G 11: 86,319,876 V480A probably benign Het
Mei1 A G 15: 82,089,609 N523S probably benign Het
Mill2 A G 7: 18,856,426 T144A probably null Het
Muc16 C A 9: 18,642,663 L4111F unknown Het
Mylk2 G A 2: 152,913,690 G258E possibly damaging Het
Myom2 T G 8: 15,065,710 S42A probably benign Het
Nab1 C A 1: 52,464,836 G401C possibly damaging Het
Nifk T C 1: 118,332,862 V244A possibly damaging Het
Nipsnap2 C A 5: 129,753,293 Q224K probably benign Het
Nop16 T G 13: 54,589,740 K47Q probably damaging Het
Nup153 A T 13: 46,699,716 S548R probably damaging Het
Olfr1284 A G 2: 111,379,002 M1V probably null Het
Olfr1465 A G 19: 13,313,634 I217T probably benign Het
Olfr521 A C 7: 99,767,717 D185A probably damaging Het
Pard6g G A 18: 80,117,319 V216I possibly damaging Het
Pcdh20 C T 14: 88,468,602 V421I probably benign Het
Pcif1 G A 2: 164,884,304 probably null Het
Pde11a C A 2: 76,337,740 V290F probably damaging Het
Pisd T C 5: 32,737,429 Y511C probably damaging Het
Polg A T 7: 79,460,657 D276E probably damaging Het
Polr3b T C 10: 84,713,632 V906A probably damaging Het
Prkcg C T 7: 3,313,819 P270S probably benign Het
Rpl13 C A 8: 123,103,275 N113K possibly damaging Het
Rxra T A 2: 27,741,174 I139N probably damaging Het
Sf3b5 T A 10: 13,008,743 C41S probably benign Het
Stk24 C T 14: 121,302,809 R126Q probably damaging Het
Taar8b T C 10: 24,092,065 D77G possibly damaging Het
Tbc1d1 T A 5: 64,311,109 C566S probably benign Het
Tenm3 A T 8: 48,298,937 M948K probably damaging Het
Thbs4 T A 13: 92,757,936 Q693L possibly damaging Het
Tnfrsf26 A T 7: 143,618,389 C61* probably null Het
Trp63 A G 16: 25,889,168 E636G probably damaging Het
Try5 T C 6: 41,311,332 Y121C probably damaging Het
Ttn G T 2: 76,830,411 probably benign Het
Vamp1 T A 6: 125,218,945 V55D probably damaging Het
Vmn2r117 T C 17: 23,479,563 N12S probably damaging Het
Vmn2r90 G A 17: 17,704,061 G41S probably damaging Het
Zfp462 T A 4: 55,007,775 D71E probably benign Het
Other mutations in Rapgef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Rapgef2 APN 3 79092025 missense possibly damaging 0.89
IGL01024:Rapgef2 APN 3 79070138 missense probably benign 0.43
IGL01448:Rapgef2 APN 3 79068937 missense probably benign
IGL01448:Rapgef2 APN 3 79103962 critical splice donor site probably null
IGL01928:Rapgef2 APN 3 79103963 missense probably damaging 1.00
IGL01973:Rapgef2 APN 3 79091809 splice site probably null
IGL02015:Rapgef2 APN 3 79092064 splice site probably benign
IGL02498:Rapgef2 APN 3 79066753 missense probably damaging 0.97
IGL02631:Rapgef2 APN 3 79083226 missense possibly damaging 0.77
IGL02835:Rapgef2 APN 3 79092986 splice site probably benign
IGL02887:Rapgef2 APN 3 79068880 splice site probably benign
IGL03030:Rapgef2 APN 3 79074307 critical splice donor site probably null
IGL03035:Rapgef2 APN 3 79094424 missense probably damaging 1.00
IGL03222:Rapgef2 APN 3 79087995 missense probably damaging 1.00
IGL03227:Rapgef2 APN 3 79092613 splice site probably benign
IGL03326:Rapgef2 APN 3 79091833 missense probably damaging 0.96
IGL03335:Rapgef2 APN 3 79099185 missense probably damaging 1.00
IGL03384:Rapgef2 APN 3 79083546 missense probably damaging 1.00
R0022:Rapgef2 UTSW 3 79087900 missense probably damaging 1.00
R0022:Rapgef2 UTSW 3 79087900 missense probably damaging 1.00
R0038:Rapgef2 UTSW 3 79069396 missense probably benign 0.00
R0117:Rapgef2 UTSW 3 79079177 missense probably benign 0.00
R0225:Rapgef2 UTSW 3 79104105 missense probably damaging 0.99
R0723:Rapgef2 UTSW 3 79079174 missense probably benign 0.20
R0788:Rapgef2 UTSW 3 79099195 missense possibly damaging 0.59
R1311:Rapgef2 UTSW 3 79083547 missense probably benign 0.12
R1374:Rapgef2 UTSW 3 79087968 missense probably benign 0.08
R1507:Rapgef2 UTSW 3 79081293 splice site probably benign
R1523:Rapgef2 UTSW 3 79092749 missense probably damaging 1.00
R1753:Rapgef2 UTSW 3 79088791 missense possibly damaging 0.65
R1759:Rapgef2 UTSW 3 79066731 missense possibly damaging 0.89
R1766:Rapgef2 UTSW 3 79092703 missense probably damaging 1.00
R2436:Rapgef2 UTSW 3 79088772 missense possibly damaging 0.95
R3033:Rapgef2 UTSW 3 79074306 critical splice donor site probably null
R3766:Rapgef2 UTSW 3 79088750 missense probably benign 0.01
R4118:Rapgef2 UTSW 3 79068887 critical splice donor site probably null
R4416:Rapgef2 UTSW 3 79069057 nonsense probably null
R4722:Rapgef2 UTSW 3 79069173 missense probably benign 0.00
R4743:Rapgef2 UTSW 3 79173068 missense probably damaging 0.99
R4780:Rapgef2 UTSW 3 79169769 splice site probably benign
R4825:Rapgef2 UTSW 3 79083227 missense probably benign 0.03
R4861:Rapgef2 UTSW 3 79074436 missense probably benign 0.01
R4861:Rapgef2 UTSW 3 79074436 missense probably benign 0.01
R4900:Rapgef2 UTSW 3 79074363 missense probably benign 0.02
R4943:Rapgef2 UTSW 3 79064547 missense probably benign 0.00
R5291:Rapgef2 UTSW 3 79070059 missense possibly damaging 0.64
R5369:Rapgef2 UTSW 3 79069432 missense probably benign 0.00
R5413:Rapgef2 UTSW 3 79087866 missense probably damaging 1.00
R5561:Rapgef2 UTSW 3 79088643 critical splice donor site probably null
R5568:Rapgef2 UTSW 3 79104001 missense probably damaging 1.00
R5642:Rapgef2 UTSW 3 79094850 missense probably damaging 1.00
R5783:Rapgef2 UTSW 3 79087993 missense probably benign 0.00
R6041:Rapgef2 UTSW 3 79069162 missense probably benign 0.00
R6193:Rapgef2 UTSW 3 79069444 missense possibly damaging 0.48
R6324:Rapgef2 UTSW 3 79079132 missense probably benign 0.01
R6551:Rapgef2 UTSW 3 79215035 splice site probably null
R6688:Rapgef2 UTSW 3 79069128 missense probably benign 0.03
R6908:Rapgef2 UTSW 3 79104063 missense probably benign 0.01
R6933:Rapgef2 UTSW 3 79085959 missense probably damaging 1.00
R7086:Rapgef2 UTSW 3 79086046 missense probably benign 0.08
R7106:Rapgef2 UTSW 3 79066608 missense probably benign
R7228:Rapgef2 UTSW 3 79069218 missense probably benign 0.03
R7242:Rapgef2 UTSW 3 79087903 nonsense probably null
R7257:Rapgef2 UTSW 3 79082627 missense probably damaging 0.99
R7322:Rapgef2 UTSW 3 79145823 start codon destroyed probably null 0.02
R7443:Rapgef2 UTSW 3 79081224 missense probably damaging 1.00
R7450:Rapgef2 UTSW 3 79173059 missense probably benign 0.01
R7472:Rapgef2 UTSW 3 79069273 missense probably benign 0.45
R7884:Rapgef2 UTSW 3 79066626 missense possibly damaging 0.49
R7967:Rapgef2 UTSW 3 79066626 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- ACCTGATGATTGCAAACATGG -3'
(R):5'- TTGGCATCTGAAGAGCTTCTG -3'

Sequencing Primer
(F):5'- CTGCAGTGCAAGGCAATC -3'
(R):5'- ATCTGAAGAGCTTCTGTTTCTTTCAG -3'
Posted On2018-11-06