Incidental Mutation 'R7257:Rapgef2'
ID 564321
Institutional Source Beutler Lab
Gene Symbol Rapgef2
Ensembl Gene ENSMUSG00000062232
Gene Name Rap guanine nucleotide exchange factor (GEF) 2
Synonyms CNRasGEF, RA-GEF-1, Pdzgef1, nRapGEP, 5830453M24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7257 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 79062516-79286517 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 79082627 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 931 (L931Q)
Ref Sequence ENSEMBL: ENSMUSP00000114119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118100] [ENSMUST00000118340] [ENSMUST00000195708]
AlphaFold Q8CHG7
Predicted Effect probably damaging
Transcript: ENSMUST00000118100
AA Change: L931Q

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114119
Gene: ENSMUSG00000062232
AA Change: L931Q

DomainStartEndE-ValueType
low complexity region 38 62 N/A INTRINSIC
low complexity region 84 95 N/A INTRINSIC
cNMP 135 253 2.48e-15 SMART
RasGEFN 267 380 1.3e-31 SMART
PDZ 395 467 1.28e-12 SMART
RA 606 692 7.59e-23 SMART
RasGEF 713 950 6.09e-100 SMART
low complexity region 1030 1046 N/A INTRINSIC
low complexity region 1110 1124 N/A INTRINSIC
low complexity region 1140 1161 N/A INTRINSIC
low complexity region 1392 1405 N/A INTRINSIC
low complexity region 1440 1455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118340
AA Change: L929Q

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113778
Gene: ENSMUSG00000062232
AA Change: L929Q

DomainStartEndE-ValueType
low complexity region 36 60 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
cNMP 133 251 2.48e-15 SMART
RasGEFN 265 378 1.3e-31 SMART
PDZ 393 465 1.28e-12 SMART
RA 604 690 7.59e-23 SMART
RasGEF 711 948 6.09e-100 SMART
low complexity region 1028 1044 N/A INTRINSIC
low complexity region 1108 1122 N/A INTRINSIC
low complexity region 1138 1159 N/A INTRINSIC
low complexity region 1390 1403 N/A INTRINSIC
low complexity region 1438 1453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195708
AA Change: L1079Q

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000141542
Gene: ENSMUSG00000062232
AA Change: L1079Q

DomainStartEndE-ValueType
cNMP 24 131 3.9e-4 SMART
low complexity region 186 210 N/A INTRINSIC
low complexity region 232 243 N/A INTRINSIC
cNMP 283 401 1.2e-17 SMART
RasGEFN 415 528 6.4e-34 SMART
PDZ 543 615 6.4e-15 SMART
RA 754 840 4.8e-25 SMART
RasGEF 861 1098 3.8e-102 SMART
low complexity region 1178 1194 N/A INTRINSIC
low complexity region 1258 1272 N/A INTRINSIC
low complexity region 1288 1309 N/A INTRINSIC
low complexity region 1540 1553 N/A INTRINSIC
low complexity region 1588 1603 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the RAS (see HRAS; MIM 190020) subfamily of GTPases function in signal transduction as GTP/GDP-regulated switches that cycle between inactive GDP- and active GTP-bound states. Guanine nucleotide exchange factors (GEFs), such as RAPGEF2, serve as RAS activators by promoting acquisition of GTP to maintain the active GTP-bound state and are the key link between cell surface receptors and RAS activation (Rebhun et al., 2000 [PubMed 10934204]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a null allele die at mid-gestation exhibiting growth arrest and defects in vascular development, neural tube closure and embryo turning. Homozygotes for another null allele show yolk sac vascular defects, impaired cell physiology and heart, primitive gut, liver and brain formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A T 6: 88,839,452 V120E probably benign Het
Acot11 G A 4: 106,758,402 T284M probably damaging Het
Adk G T 14: 21,052,671 K11N probably damaging Het
Akr1c14 T A 13: 4,088,966 N316K probably benign Het
AL732309.1 A T 2: 25,245,839 V121D probably benign Het
Amh C A 10: 80,806,653 Q257K probably benign Het
Antxrl T G 14: 34,065,849 H276Q probably benign Het
Atp5o G A 16: 91,926,867 T105M probably damaging Het
Atp5s T C 12: 69,741,669 I114T probably damaging Het
Atxn2 T G 5: 121,785,817 N734K possibly damaging Het
B3gat3 T A 19: 8,925,738 V153D probably benign Het
Brd2 A G 17: 34,113,822 V528A probably damaging Het
Camk2g T C 14: 20,747,839 S335G probably benign Het
Cbln2 T A 18: 86,716,734 W211R probably damaging Het
Cry2 A T 2: 92,412,981 I505N possibly damaging Het
Ddx55 T A 5: 124,560,721 C249S possibly damaging Het
Dglucy A G 12: 100,842,738 T232A probably damaging Het
Dhx32 A G 7: 133,759,477 Y76H probably benign Het
Dock7 T A 4: 98,973,412 N1356I unknown Het
Dock8 T A 19: 25,127,085 N710K probably benign Het
Dync1i2 T A 2: 71,249,356 N391K possibly damaging Het
Ect2 A G 3: 27,138,535 S420P probably damaging Het
Efcab5 T A 11: 77,137,779 E242V probably damaging Het
Fam83g T A 11: 61,684,753 Y74N probably damaging Het
Fbxo34 T A 14: 47,500,872 probably null Het
Flt4 A G 11: 49,626,009 T208A probably benign Het
Fxyd5 T A 7: 31,035,151 H183L unknown Het
Gpr150 T G 13: 76,056,466 D120A probably benign Het
Grm7 A G 6: 110,646,118 Y84C probably damaging Het
Ighmbp2 A G 19: 3,266,405 S562P probably damaging Het
Itga7 A G 10: 128,944,413 Y530C possibly damaging Het
Itpr3 T A 17: 27,118,561 D2448E probably benign Het
Mmp17 C A 5: 129,595,633 H216Q probably benign Het
Mns1 C T 9: 72,452,815 R416W probably damaging Het
Mog A G 17: 37,023,127 S25P unknown Het
Myh2 A G 11: 67,181,150 K568R possibly damaging Het
Myh7 A T 14: 54,972,490 probably null Het
Mymk A T 2: 27,067,368 W79R probably damaging Het
Ncoa4 T G 14: 32,177,369 L623R probably damaging Het
Oca2 G A 7: 56,279,538 probably benign Het
Odam A C 5: 87,887,545 S123R probably benign Het
Olfr1155 A G 2: 87,943,571 F19S probably damaging Het
Olfr263 A G 13: 21,133,257 T161A probably benign Het
Olfr292 T A 7: 86,694,804 M116K probably damaging Het
Olfr583 T C 7: 103,051,630 F111L probably benign Het
Olfr765 C T 10: 129,046,455 V203M probably benign Het
Olfr816 T A 10: 129,912,287 probably benign Het
Ovch2 C T 7: 107,794,433 C162Y probably damaging Het
Padi1 C A 4: 140,829,471 G142C probably damaging Het
Pcdhga4 A G 18: 37,687,398 I667V probably damaging Het
Pfas A T 11: 68,992,959 V624E probably damaging Het
Phb A T 11: 95,678,091 E184V probably damaging Het
Phlpp2 G T 8: 109,940,188 M1116I probably benign Het
Pip5kl1 T C 2: 32,580,431 probably null Het
Pitpnm2 T A 5: 124,125,356 I824F possibly damaging Het
Pla2g4c G A 7: 13,325,744 S2N possibly damaging Het
Pla2r1 A T 2: 60,427,625 probably null Het
Pole2 T C 12: 69,202,910 D521G probably damaging Het
Ptch1 T C 13: 63,573,294 K54E not run Het
Rassf3 G A 10: 121,413,019 Q206* probably null Het
Rnf123 T A 9: 108,069,029 T316S probably damaging Het
Rnf138 T A 18: 21,008,693 probably null Het
Sept3 G A 15: 82,289,213 A249T probably damaging Het
Slc35a4 A T 18: 36,679,616 D3V unknown Het
Sltm T A 9: 70,543,965 probably null Het
Smarca2 C T 19: 26,654,464 Q560* probably null Het
Tcl1b1 A T 12: 105,164,531 D91V probably damaging Het
Tirap A T 9: 35,189,034 V118E probably damaging Het
Tlr5 T A 1: 182,974,233 Y367* probably null Het
Tmcc1 A G 6: 116,107,338 F5L probably benign Het
Tnxb A G 17: 34,716,501 M2592V probably benign Het
Trim66 T A 7: 109,460,244 E931V probably damaging Het
Ttn A G 2: 76,741,094 I26485T probably damaging Het
Veph1 C A 3: 66,158,282 V455L probably benign Het
Vmn1r125 A T 7: 21,272,825 H216L probably damaging Het
Wdr17 T A 8: 54,632,487 E1200D probably benign Het
Zbtb37 T A 1: 161,032,661 N25Y probably damaging Het
Other mutations in Rapgef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Rapgef2 APN 3 79092025 missense possibly damaging 0.89
IGL01024:Rapgef2 APN 3 79070138 missense probably benign 0.43
IGL01448:Rapgef2 APN 3 79068937 missense probably benign
IGL01448:Rapgef2 APN 3 79103962 critical splice donor site probably null
IGL01928:Rapgef2 APN 3 79103963 missense probably damaging 1.00
IGL01973:Rapgef2 APN 3 79091809 splice site probably null
IGL02015:Rapgef2 APN 3 79092064 splice site probably benign
IGL02498:Rapgef2 APN 3 79066753 missense probably damaging 0.97
IGL02631:Rapgef2 APN 3 79083226 missense possibly damaging 0.77
IGL02835:Rapgef2 APN 3 79092986 splice site probably benign
IGL02887:Rapgef2 APN 3 79068880 splice site probably benign
IGL03030:Rapgef2 APN 3 79074307 critical splice donor site probably null
IGL03035:Rapgef2 APN 3 79094424 missense probably damaging 1.00
IGL03222:Rapgef2 APN 3 79087995 missense probably damaging 1.00
IGL03227:Rapgef2 APN 3 79092613 splice site probably benign
IGL03326:Rapgef2 APN 3 79091833 missense probably damaging 0.96
IGL03335:Rapgef2 APN 3 79099185 missense probably damaging 1.00
IGL03384:Rapgef2 APN 3 79083546 missense probably damaging 1.00
Bulge UTSW 3 79079132 missense probably benign 0.01
Hai_phat UTSW 3 79085959 missense probably damaging 1.00
R0022:Rapgef2 UTSW 3 79087900 missense probably damaging 1.00
R0022:Rapgef2 UTSW 3 79087900 missense probably damaging 1.00
R0038:Rapgef2 UTSW 3 79069396 missense probably benign 0.00
R0117:Rapgef2 UTSW 3 79079177 missense probably benign 0.00
R0225:Rapgef2 UTSW 3 79104105 missense probably damaging 0.99
R0723:Rapgef2 UTSW 3 79079174 missense probably benign 0.20
R0788:Rapgef2 UTSW 3 79099195 missense possibly damaging 0.59
R1311:Rapgef2 UTSW 3 79083547 missense probably benign 0.12
R1374:Rapgef2 UTSW 3 79087968 missense probably benign 0.08
R1507:Rapgef2 UTSW 3 79081293 splice site probably benign
R1523:Rapgef2 UTSW 3 79092749 missense probably damaging 1.00
R1753:Rapgef2 UTSW 3 79088791 missense possibly damaging 0.65
R1759:Rapgef2 UTSW 3 79066731 missense possibly damaging 0.89
R1766:Rapgef2 UTSW 3 79092703 missense probably damaging 1.00
R2436:Rapgef2 UTSW 3 79088772 missense possibly damaging 0.95
R3033:Rapgef2 UTSW 3 79074306 critical splice donor site probably null
R3766:Rapgef2 UTSW 3 79088750 missense probably benign 0.01
R4118:Rapgef2 UTSW 3 79068887 critical splice donor site probably null
R4416:Rapgef2 UTSW 3 79069057 nonsense probably null
R4722:Rapgef2 UTSW 3 79069173 missense probably benign 0.00
R4743:Rapgef2 UTSW 3 79173068 missense probably damaging 0.99
R4780:Rapgef2 UTSW 3 79169769 splice site probably benign
R4825:Rapgef2 UTSW 3 79083227 missense probably benign 0.03
R4861:Rapgef2 UTSW 3 79074436 missense probably benign 0.01
R4861:Rapgef2 UTSW 3 79074436 missense probably benign 0.01
R4900:Rapgef2 UTSW 3 79074363 missense probably benign 0.02
R4943:Rapgef2 UTSW 3 79064547 missense probably benign 0.00
R5291:Rapgef2 UTSW 3 79070059 missense possibly damaging 0.64
R5369:Rapgef2 UTSW 3 79069432 missense probably benign 0.00
R5413:Rapgef2 UTSW 3 79087866 missense probably damaging 1.00
R5561:Rapgef2 UTSW 3 79088643 critical splice donor site probably null
R5568:Rapgef2 UTSW 3 79104001 missense probably damaging 1.00
R5642:Rapgef2 UTSW 3 79094850 missense probably damaging 1.00
R5783:Rapgef2 UTSW 3 79087993 missense probably benign 0.00
R6041:Rapgef2 UTSW 3 79069162 missense probably benign 0.00
R6193:Rapgef2 UTSW 3 79069444 missense possibly damaging 0.48
R6324:Rapgef2 UTSW 3 79079132 missense probably benign 0.01
R6551:Rapgef2 UTSW 3 79215035 splice site probably null
R6688:Rapgef2 UTSW 3 79069128 missense probably benign 0.03
R6908:Rapgef2 UTSW 3 79104063 missense probably benign 0.01
R6913:Rapgef2 UTSW 3 79085974 missense probably damaging 1.00
R6933:Rapgef2 UTSW 3 79085959 missense probably damaging 1.00
R7086:Rapgef2 UTSW 3 79086046 missense probably benign 0.08
R7106:Rapgef2 UTSW 3 79066608 missense probably benign
R7228:Rapgef2 UTSW 3 79069218 missense probably benign 0.03
R7242:Rapgef2 UTSW 3 79087903 nonsense probably null
R7322:Rapgef2 UTSW 3 79145823 start codon destroyed probably null 0.02
R7443:Rapgef2 UTSW 3 79081224 missense probably damaging 1.00
R7450:Rapgef2 UTSW 3 79173059 missense probably benign 0.01
R7472:Rapgef2 UTSW 3 79069273 missense probably benign 0.45
R7884:Rapgef2 UTSW 3 79066626 missense possibly damaging 0.49
R7954:Rapgef2 UTSW 3 79070147 nonsense probably null
R7957:Rapgef2 UTSW 3 79214969 missense probably benign 0.27
R8071:Rapgef2 UTSW 3 79093036 missense probably damaging 1.00
R8261:Rapgef2 UTSW 3 79086018 missense probably benign 0.34
R8268:Rapgef2 UTSW 3 79085956 missense probably benign 0.12
R8309:Rapgef2 UTSW 3 79083202 missense possibly damaging 0.65
R8505:Rapgef2 UTSW 3 79079042 nonsense probably null
R8783:Rapgef2 UTSW 3 79098344 missense probably damaging 1.00
R8897:Rapgef2 UTSW 3 79112259 missense probably damaging 1.00
R8965:Rapgef2 UTSW 3 79092544 missense probably damaging 1.00
R9028:Rapgef2 UTSW 3 79074344 missense probably damaging 1.00
R9284:Rapgef2 UTSW 3 79092703 missense probably damaging 1.00
R9371:Rapgef2 UTSW 3 79174993 missense probably damaging 1.00
R9479:Rapgef2 UTSW 3 79112188 missense probably damaging 1.00
R9493:Rapgef2 UTSW 3 79112188 missense probably damaging 1.00
R9494:Rapgef2 UTSW 3 79112188 missense probably damaging 1.00
R9500:Rapgef2 UTSW 3 79066786 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGACTTCAGGAATGCCCCAAC -3'
(R):5'- AAGCAGTGGTTAGCTCAGTGG -3'

Sequencing Primer
(F):5'- GGAATGCCCCAACACATTAAATCTG -3'
(R):5'- GGAACAAAATTGTAGTCCTCTAAGCC -3'
Posted On 2019-06-26