Incidental Mutation 'R7141:Mrpl41'
ID553322
Institutional Source Beutler Lab
Gene Symbol Mrpl41
Ensembl Gene ENSMUSG00000036850
Gene Namemitochondrial ribosomal protein L41
SynonymsRpml27, MRP-L27
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7141 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location24974117-24975098 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24974456 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 68 (L68P)
Ref Sequence ENSEMBL: ENSMUSP00000043561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028351] [ENSMUST00000045295] [ENSMUST00000045604] [ENSMUST00000124383] [ENSMUST00000126909] [ENSMUST00000137913] [ENSMUST00000152777] [ENSMUST00000153618] [ENSMUST00000194392]
Predicted Effect probably benign
Transcript: ENSMUST00000028351
SMART Domains Protein: ENSMUSP00000028351
Gene: ENSMUSG00000026975

DomainStartEndE-ValueType
Blast:WD40 74 118 3e-10 BLAST
Blast:WD40 128 175 3e-15 BLAST
WD40 183 223 7.43e-1 SMART
WD40 227 267 1.08e-4 SMART
WD40 271 310 1.37e2 SMART
WD40 420 455 1.97e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000045295
SMART Domains Protein: ENSMUSP00000044078
Gene: ENSMUSG00000036833

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
low complexity region 59 66 N/A INTRINSIC
cNMP 170 295 2.06e-12 SMART
low complexity region 439 444 N/A INTRINSIC
cNMP 481 600 1.16e-6 SMART
cNMP 603 716 1.55e-7 SMART
Pfam:Patatin 950 1116 3.2e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000045604
AA Change: L68P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043561
Gene: ENSMUSG00000036850
AA Change: L68P

DomainStartEndE-ValueType
Pfam:MRP-L27 13 125 1.3e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124383
Predicted Effect probably benign
Transcript: ENSMUST00000126909
Predicted Effect probably benign
Transcript: ENSMUST00000137913
SMART Domains Protein: ENSMUSP00000141577
Gene: ENSMUSG00000036833

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
low complexity region 33 40 N/A INTRINSIC
Pfam:cNMP_binding 162 200 2.7e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152777
SMART Domains Protein: ENSMUSP00000122394
Gene: ENSMUSG00000036833

DomainStartEndE-ValueType
cNMP 89 179 4.98e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153618
SMART Domains Protein: ENSMUSP00000117428
Gene: ENSMUSG00000036833

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
low complexity region 57 64 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194392
SMART Domains Protein: ENSMUSP00000141974
Gene: ENSMUSG00000036850

DomainStartEndE-ValueType
Pfam:MRP-L27 56 98 1.1e-12 PFAM
Meta Mutation Damage Score 0.6922 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein that belongs to the YmL27 ribosomal protein family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit flattened pancake appearance at E9. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A C 1: 74,284,111 probably null Het
Abhd10 C T 16: 45,742,806 R29Q probably benign Het
Adgrv1 A G 13: 81,492,501 Y3369H probably benign Het
Agl A G 3: 116,753,286 I1305T probably benign Het
Apba3 A G 10: 81,273,055 I551V probably damaging Het
Appbp2 A T 11: 85,191,751 Y551* probably null Het
Btbd17 T C 11: 114,791,815 N357S possibly damaging Het
Casp2 T C 6: 42,280,395 F426S possibly damaging Het
Cdh5 A G 8: 104,113,001 N35D probably benign Het
Cep350 G T 1: 155,914,748 Q1354K probably damaging Het
Cep44 A G 8: 56,539,851 C243R probably damaging Het
Chst4 A T 8: 110,030,839 S131T probably damaging Het
Cox15 T C 19: 43,736,747 N406D probably benign Het
Cttnbp2 C T 6: 18,380,468 R1467H probably benign Het
Dock8 A G 19: 25,181,620 D1714G probably null Het
Erbb2 G T 11: 98,427,309 R457L probably damaging Het
Esyt3 T C 9: 99,321,440 N463S probably benign Het
Fam171a1 C T 2: 3,225,152 Q441* probably null Het
Fam186b T A 15: 99,283,892 M142L probably benign Het
Git2 G T 5: 114,769,698 C35* probably null Het
Gm21103 T G 14: 6,301,807 Q202P probably damaging Het
Gm5622 G T 14: 51,655,882 E89* probably null Het
Hmcn2 C A 2: 31,360,896 T790K probably benign Het
Hspg2 T A 4: 137,552,116 L3114H probably damaging Het
Igkv3-10 A T 6: 70,572,981 Q37L possibly damaging Het
Kcp G T 6: 29,487,512 Y1106* probably null Het
Khsrp T C 17: 57,025,602 D226G possibly damaging Het
Klre1 T A 6: 129,583,166 W134R probably damaging Het
Lrrc66 A G 5: 73,629,977 I10T probably benign Het
Map4 T C 9: 109,978,870 M1T probably null Het
Met T A 6: 17,527,155 I535K probably benign Het
Mrgprb1 A G 7: 48,447,687 V159A possibly damaging Het
Mtmr4 T C 11: 87,600,613 W135R probably damaging Het
Mut T C 17: 40,952,839 V500A possibly damaging Het
Myh10 A G 11: 68,802,139 D1420G probably benign Het
Naglu A C 11: 101,072,230 D229A probably benign Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Ncln G T 10: 81,487,849 Y517* probably null Het
Nr1h4 G A 10: 89,498,229 R100* probably null Het
Olfr173 G A 16: 58,797,408 T146M probably benign Het
P2rx5 A T 11: 73,160,648 T18S probably damaging Het
Pclo T C 5: 14,679,257 S2710P unknown Het
Pdhx A T 2: 103,073,314 F46I probably benign Het
Piezo2 A T 18: 63,145,110 L241* probably null Het
Pitpnm1 G A 19: 4,102,787 V65M probably damaging Het
Rgs3 A G 4: 62,690,487 D330G probably damaging Het
Scaf8 T C 17: 3,159,182 V60A unknown Het
Sema4c A G 1: 36,553,020 Y249H probably damaging Het
Spp2 T C 1: 88,407,328 Y27H probably damaging Het
Sugct T A 13: 17,644,787 I158F possibly damaging Het
Sympk A T 7: 19,054,092 I1178F probably benign Het
Tmppe T C 9: 114,404,968 Y112H probably benign Het
Trp53bp2 A G 1: 182,448,508 T187A Het
Tspoap1 A G 11: 87,774,697 S754G probably damaging Het
Vmn1r214 C T 13: 23,034,669 A111V probably benign Het
Vmn2r70 G C 7: 85,558,836 S811C probably benign Het
Zfp638 T C 6: 83,867,199 S15P unknown Het
Zfp763 A G 17: 33,018,795 S459P probably damaging Het
Other mutations in Mrpl41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Mrpl41 APN 2 24974441 missense probably benign 0.00
IGL01710:Mrpl41 APN 2 24974417 missense possibly damaging 0.62
IGL02019:Mrpl41 APN 2 24974417 missense possibly damaging 0.62
IGL02037:Mrpl41 APN 2 24974417 missense possibly damaging 0.62
R1727:Mrpl41 UTSW 2 24974624 missense probably damaging 1.00
R4424:Mrpl41 UTSW 2 24974406 missense possibly damaging 0.91
R5060:Mrpl41 UTSW 2 24974283 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGCTTGCCTTCCTGTG -3'
(R):5'- AGCTGATTTATCCAGAGCCCAG -3'

Sequencing Primer
(F):5'- CCTTCCTGTGTGGGCTCGAAG -3'
(R):5'- TGATTTATCCAGAGCCCAGCATGG -3'
Posted On2019-05-15