Incidental Mutation 'PIT4449001:Ddr1'
ID555754
Institutional Source Beutler Lab
Gene Symbol Ddr1
Ensembl Gene ENSMUSG00000003534
Gene Namediscoidin domain receptor family, member 1
SynonymsCak, CD167a
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock #PIT4449001 (G1)
Quality Score161.009
Status Not validated
Chromosome17
Chromosomal Location35681567-35704621 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35687249 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 468 (I468T)
Ref Sequence ENSEMBL: ENSMUSP00000003628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003628] [ENSMUST00000097333] [ENSMUST00000117301] [ENSMUST00000119825] [ENSMUST00000134995] [ENSMUST00000145900] [ENSMUST00000146472] [ENSMUST00000148065] [ENSMUST00000155628] [ENSMUST00000155957] [ENSMUST00000166980]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003628
AA Change: I468T

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000003628
Gene: ENSMUSG00000003534
AA Change: I468T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 1.3e-36 SMART
low complexity region 218 236 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 473 492 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 548 565 N/A INTRINSIC
TyrKc 608 903 3.9e-131 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000097333
AA Change: I468T

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000094945
Gene: ENSMUSG00000003534
AA Change: I468T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 2.75e-34 SMART
low complexity region 218 236 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 473 492 N/A INTRINSIC
low complexity region 511 528 N/A INTRINSIC
TyrKc 571 866 8.14e-129 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000117301
AA Change: I468T

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112570
Gene: ENSMUSG00000003534
AA Change: I468T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 1.3e-36 SMART
low complexity region 218 236 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 473 492 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 548 565 N/A INTRINSIC
TyrKc 608 903 4e-131 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119825
AA Change: I468T

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113062
Gene: ENSMUSG00000003534
AA Change: I468T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 1.3e-36 SMART
low complexity region 218 236 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 473 492 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 548 565 N/A INTRINSIC
TyrKc 608 903 3.9e-131 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134995
SMART Domains Protein: ENSMUSP00000117301
Gene: ENSMUSG00000003534

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 2.75e-34 SMART
low complexity region 218 236 N/A INTRINSIC
Blast:FA58C 239 264 2e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000145900
SMART Domains Protein: ENSMUSP00000122361
Gene: ENSMUSG00000003534

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 2.75e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146472
SMART Domains Protein: ENSMUSP00000119397
Gene: ENSMUSG00000003534

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 2.75e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148065
SMART Domains Protein: ENSMUSP00000120635
Gene: ENSMUSG00000003534

DomainStartEndE-ValueType
Blast:FA58C 1 56 2e-33 BLAST
SCOP:d1d7pm_ 1 58 2e-11 SMART
PDB:4AG4|A 1 143 3e-73 PDB
Blast:FA58C 109 143 1e-13 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000155628
AA Change: I468T

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133659
Gene: ENSMUSG00000003534
AA Change: I468T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 2.75e-34 SMART
low complexity region 218 236 N/A INTRINSIC
Blast:FA58C 239 319 1e-45 BLAST
low complexity region 379 390 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 473 492 N/A INTRINSIC
low complexity region 511 528 N/A INTRINSIC
PDB:4CKR|A 562 584 3e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000155957
SMART Domains Protein: ENSMUSP00000117427
Gene: ENSMUSG00000003534

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 2.75e-34 SMART
low complexity region 192 209 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166980
AA Change: I468T

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133047
Gene: ENSMUSG00000003534
AA Change: I468T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 1.3e-36 SMART
low complexity region 218 236 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 473 492 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 548 565 N/A INTRINSIC
TyrKc 608 903 3.9e-131 SMART
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Receptor tyrosine kinases play a key role in the communication of cells with their microenvironment. These kinases are involved in the regulation of cell growth, differentiation and metabolism. The protein encoded by this gene belongs to a subfamily of tyrosine kinase receptors with homology to Dictyostelium discoideum protein discoidin I in their extracellular domain, and that are activated by various types of collagen. Expression of this protein is restricted to epithelial cells, particularly in the kidney, lung, gastrointestinal tract, and brain. In addition, it has been shown to be significantly overexpressed in several human tumors. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous mutant mice are viable but smaller than control mice. Most mutant females are not able to give birth because developing blastocysts fail to implant. Successfully reproducing females show a lactation defect which is attributed to hyperproliferation and aberrant branching of mammary ducts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asf1b A G 8: 83,967,982 N125S probably benign Het
BC048671 T A 6: 90,305,163 L101I probably damaging Het
Camta1 A G 4: 151,131,586 L959P probably benign Het
Cfh C A 1: 140,112,565 V598F probably damaging Het
Cyp2j7 G T 4: 96,215,338 T320K probably damaging Het
Dhx15 A G 5: 52,160,958 V510A probably damaging Het
Dpp4 T A 2: 62,356,644 K507N probably benign Het
Evpl G A 11: 116,233,399 T198M possibly damaging Het
Gabbr1 G A 17: 37,056,350 V373I probably damaging Het
Gak A T 5: 108,580,925 S1049T probably benign Het
Gipr C T 7: 19,160,618 R253H probably benign Het
Gm3685 T A 14: 7,043,960 M73L probably benign Het
Gm5168 C T X: 26,039,540 R129Q probably null Het
Kcnh1 T A 1: 192,418,684 V555D probably damaging Het
Kif26b T C 1: 178,918,086 S1916P probably damaging Het
Lingo4 T C 3: 94,401,932 V59A probably benign Het
Maats1 T C 16: 38,328,358 E236G probably damaging Het
Mroh8 T A 2: 157,225,534 Q635L probably damaging Het
Msh6 T A 17: 87,986,188 D790E probably damaging Het
Nrxn1 A T 17: 90,597,579 W809R probably damaging Het
Olfr201 C A 16: 59,269,130 C179F probably damaging Het
Polr3d T C 14: 70,439,463 H397R probably benign Het
Pwp2 G A 10: 78,178,470 T432I probably benign Het
Rad21 G C 15: 51,973,243 F177L probably benign Het
Rnf182 G A 13: 43,668,677 V235I probably benign Het
Scn11a C T 9: 119,769,948 C1172Y probably damaging Het
Sh2b3 A G 5: 121,828,679 L124P possibly damaging Het
Six2 T C 17: 85,685,478 N199S probably benign Het
Slc5a3 A G 16: 92,077,814 D253G probably benign Het
Synm A G 7: 67,735,277 M879T probably benign Het
Tasp1 A G 2: 139,910,535 I328T possibly damaging Het
Tbrg4 T C 11: 6,619,689 Q309R probably damaging Het
Tcrg-C3 A T 13: 19,263,362 R162* probably null Het
Tmtc2 A G 10: 105,303,604 L687P probably damaging Het
Tufm T C 7: 126,487,449 M1T probably null Het
Vmn2r116 A C 17: 23,388,947 L496F probably benign Het
Vmn2r75 C T 7: 86,165,583 C234Y probably damaging Het
Wars2 G T 3: 99,205,279 V162L possibly damaging Het
Zc3h11a A T 1: 133,624,611 V586D probably benign Het
Zdhhc5 A T 2: 84,690,227 N535K probably damaging Het
Zfp52 T C 17: 21,557,216 Y38H probably damaging Het
Zfp729b T C 13: 67,591,423 M908V probably benign Het
Zfp772 T C 7: 7,204,351 I114V probably benign Het
Other mutations in Ddr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02021:Ddr1 APN 17 35683480 missense probably damaging 1.00
IGL02126:Ddr1 APN 17 35688589 missense probably damaging 0.99
IGL02167:Ddr1 APN 17 35690071 missense possibly damaging 0.55
IGL02250:Ddr1 APN 17 35683480 missense probably damaging 1.00
IGL02251:Ddr1 APN 17 35683480 missense probably damaging 1.00
IGL02367:Ddr1 APN 17 35683480 missense probably damaging 1.00
R0538:Ddr1 UTSW 17 35685007 missense probably damaging 1.00
R0674:Ddr1 UTSW 17 35689669 nonsense probably null
R4829:Ddr1 UTSW 17 35685113 missense probably damaging 1.00
R4940:Ddr1 UTSW 17 35690130 missense probably damaging 1.00
R5085:Ddr1 UTSW 17 35682775 critical splice acceptor site probably null
R5112:Ddr1 UTSW 17 35682485 missense probably benign
R5124:Ddr1 UTSW 17 35683597 missense probably damaging 1.00
R5652:Ddr1 UTSW 17 35686508 missense probably benign
R5653:Ddr1 UTSW 17 35686508 missense probably benign
R5654:Ddr1 UTSW 17 35686508 missense probably benign
R6427:Ddr1 UTSW 17 35687222 missense probably benign
R7226:Ddr1 UTSW 17 35691147 missense possibly damaging 0.94
R7405:Ddr1 UTSW 17 35690100 missense probably damaging 1.00
R7534:Ddr1 UTSW 17 35682622 critical splice donor site probably null
R7568:Ddr1 UTSW 17 35684282 missense probably damaging 1.00
R8010:Ddr1 UTSW 17 35691492 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ATTGGAGCTGGTATAGACAGTATG -3'
(R):5'- ATGCCCTGGACTTCCACATG -3'

Sequencing Primer
(F):5'- TATAGACAGTATGGGAGGAGGGCTAC -3'
(R):5'- GGACTTCCACATGTCCATTGTGG -3'
Posted On2019-06-07