Incidental Mutation 'PIT4449001:Olfr201'
ID555750
Institutional Source Beutler Lab
Gene Symbol Olfr201
Ensembl Gene ENSMUSG00000074995
Gene Nameolfactory receptor 201
SynonymsGA_x54KRFPKG5P-55483936-55483010, MOR182-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #PIT4449001 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location59266113-59272632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 59269130 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 179 (C179F)
Ref Sequence ENSEMBL: ENSMUSP00000150660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099656] [ENSMUST00000216834]
Predicted Effect probably damaging
Transcript: ENSMUST00000099656
AA Change: C179F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097248
Gene: ENSMUSG00000074995
AA Change: C179F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.2e-46 PFAM
Pfam:7tm_1 41 290 8e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216834
AA Change: C179F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asf1b A G 8: 83,967,982 N125S probably benign Het
BC048671 T A 6: 90,305,163 L101I probably damaging Het
Camta1 A G 4: 151,131,586 L959P probably benign Het
Cfh C A 1: 140,112,565 V598F probably damaging Het
Cyp2j7 G T 4: 96,215,338 T320K probably damaging Het
Ddr1 A G 17: 35,687,249 I468T possibly damaging Het
Dhx15 A G 5: 52,160,958 V510A probably damaging Het
Dpp4 T A 2: 62,356,644 K507N probably benign Het
Evpl G A 11: 116,233,399 T198M possibly damaging Het
Gabbr1 G A 17: 37,056,350 V373I probably damaging Het
Gak A T 5: 108,580,925 S1049T probably benign Het
Gipr C T 7: 19,160,618 R253H probably benign Het
Gm3685 T A 14: 7,043,960 M73L probably benign Het
Gm5168 C T X: 26,039,540 R129Q probably null Het
Kcnh1 T A 1: 192,418,684 V555D probably damaging Het
Kif26b T C 1: 178,918,086 S1916P probably damaging Het
Lingo4 T C 3: 94,401,932 V59A probably benign Het
Maats1 T C 16: 38,328,358 E236G probably damaging Het
Mroh8 T A 2: 157,225,534 Q635L probably damaging Het
Msh6 T A 17: 87,986,188 D790E probably damaging Het
Nrxn1 A T 17: 90,597,579 W809R probably damaging Het
Polr3d T C 14: 70,439,463 H397R probably benign Het
Pwp2 G A 10: 78,178,470 T432I probably benign Het
Rad21 G C 15: 51,973,243 F177L probably benign Het
Rnf182 G A 13: 43,668,677 V235I probably benign Het
Scn11a C T 9: 119,769,948 C1172Y probably damaging Het
Sh2b3 A G 5: 121,828,679 L124P possibly damaging Het
Six2 T C 17: 85,685,478 N199S probably benign Het
Slc5a3 A G 16: 92,077,814 D253G probably benign Het
Synm A G 7: 67,735,277 M879T probably benign Het
Tasp1 A G 2: 139,910,535 I328T possibly damaging Het
Tbrg4 T C 11: 6,619,689 Q309R probably damaging Het
Tcrg-C3 A T 13: 19,263,362 R162* probably null Het
Tmtc2 A G 10: 105,303,604 L687P probably damaging Het
Tufm T C 7: 126,487,449 M1T probably null Het
Vmn2r116 A C 17: 23,388,947 L496F probably benign Het
Vmn2r75 C T 7: 86,165,583 C234Y probably damaging Het
Wars2 G T 3: 99,205,279 V162L possibly damaging Het
Zc3h11a A T 1: 133,624,611 V586D probably benign Het
Zdhhc5 A T 2: 84,690,227 N535K probably damaging Het
Zfp52 T C 17: 21,557,216 Y38H probably damaging Het
Zfp729b T C 13: 67,591,423 M908V probably benign Het
Zfp772 T C 7: 7,204,351 I114V probably benign Het
Other mutations in Olfr201
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Olfr201 APN 16 59268850 missense probably benign 0.07
IGL01985:Olfr201 APN 16 59269079 missense probably benign
IGL02618:Olfr201 APN 16 59268927 missense probably damaging 1.00
IGL02830:Olfr201 APN 16 59269053 missense possibly damaging 0.94
R0047:Olfr201 UTSW 16 59269211 missense probably damaging 1.00
R0047:Olfr201 UTSW 16 59269211 missense probably damaging 1.00
R1035:Olfr201 UTSW 16 59268944 missense probably damaging 1.00
R1037:Olfr201 UTSW 16 59268944 missense probably damaging 1.00
R1163:Olfr201 UTSW 16 59269155 missense probably benign 0.23
R1225:Olfr201 UTSW 16 59269224 missense probably benign
R1519:Olfr201 UTSW 16 59268944 missense probably damaging 1.00
R1583:Olfr201 UTSW 16 59269031 missense probably benign 0.00
R2075:Olfr201 UTSW 16 59268911 missense possibly damaging 0.60
R4591:Olfr201 UTSW 16 59269413 missense possibly damaging 0.94
R5547:Olfr201 UTSW 16 59269116 missense probably benign 0.35
R6132:Olfr201 UTSW 16 59269004 missense probably damaging 0.97
R6737:Olfr201 UTSW 16 59268812 missense possibly damaging 0.60
R6872:Olfr201 UTSW 16 59269598 missense probably benign 0.20
R8001:Olfr201 UTSW 16 59269109 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCATGTAGAGAAGGCTTTGC -3'
(R):5'- ACCACGGAATGCTTTCTCC -3'

Sequencing Primer
(F):5'- TAGAGAAGGCTTTGCTTCTGCCC -3'
(R):5'- GATGGCCTATGACCGCTATCTG -3'
Posted On2019-06-07