Incidental Mutation 'R7203:Ncapd2'
ID 560776
Institutional Source Beutler Lab
Gene Symbol Ncapd2
Ensembl Gene ENSMUSG00000038252
Gene Name non-SMC condensin I complex, subunit D2
Synonyms 2810406C15Rik, CAP-D2, CNAP1, 2810465G24Rik
MMRRC Submission 045281-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.969) question?
Stock # R7203 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 125144970-125168664 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 125161291 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 247 (M247K)
Ref Sequence ENSEMBL: ENSMUSP00000042260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043848] [ENSMUST00000188762] [ENSMUST00000189959]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000043848
AA Change: M247K

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000042260
Gene: ENSMUSG00000038252
AA Change: M247K

DomainStartEndE-ValueType
Pfam:Cnd1_N 75 240 1.4e-41 PFAM
low complexity region 461 472 N/A INTRINSIC
low complexity region 936 949 N/A INTRINSIC
Pfam:Cnd1 1058 1224 2.5e-65 PFAM
low complexity region 1329 1345 N/A INTRINSIC
low complexity region 1357 1369 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188762
Predicted Effect probably benign
Transcript: ENSMUST00000189959
SMART Domains Protein: ENSMUSP00000139445
Gene: ENSMUSG00000038252

DomainStartEndE-ValueType
Pfam:Cnd1_N 73 162 8.3e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (108/108)
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544G11Rik T C 6: 65,930,317 (GRCm39) V184A probably benign Het
Aars2 A G 17: 45,827,497 (GRCm39) Y513C probably damaging Het
Ackr2 G A 9: 121,738,033 (GRCm39) C136Y probably damaging Het
Aldh1l1 A G 6: 90,547,782 (GRCm39) K414R probably benign Het
Arl9 A G 5: 77,155,118 (GRCm39) Y83C possibly damaging Het
Atp10a G T 7: 58,436,221 (GRCm39) R337L probably benign Het
Atp6v1g3 A T 1: 138,215,538 (GRCm39) Q66L probably damaging Het
Atp7b A T 8: 22,487,351 (GRCm39) N1321K probably damaging Het
Axdnd1 A T 1: 156,209,959 (GRCm39) M437K probably damaging Het
Bap1 C A 14: 30,976,126 (GRCm39) P147Q probably damaging Het
Bicd1 C T 6: 149,414,403 (GRCm39) T372I possibly damaging Het
Brix1 T C 15: 10,483,378 (GRCm39) probably null Het
Btrc A G 19: 45,501,967 (GRCm39) probably null Het
C130050O18Rik A C 5: 139,400,129 (GRCm39) I61L probably benign Het
Cfap161 A G 7: 83,425,258 (GRCm39) S278P probably damaging Het
Cgnl1 T C 9: 71,631,815 (GRCm39) D512G possibly damaging Het
Chat T C 14: 32,141,014 (GRCm39) D461G probably damaging Het
Chl1 T A 6: 103,668,635 (GRCm39) V456D probably benign Het
Cib1 T C 7: 79,882,120 (GRCm39) T20A possibly damaging Het
Cubn T G 2: 13,355,814 (GRCm39) H1806P probably benign Het
Dapk1 T A 13: 60,844,149 (GRCm39) V56E possibly damaging Het
Dennd4a A G 9: 64,803,756 (GRCm39) N1032D probably benign Het
Dlg5 T A 14: 24,188,723 (GRCm39) E1756V probably damaging Het
Dnah1 T C 14: 30,996,339 (GRCm39) T2666A probably benign Het
Dnah11 A T 12: 118,009,257 (GRCm39) I2135N possibly damaging Het
Dnah6 T A 6: 73,150,528 (GRCm39) E745V probably benign Het
Dock8 A T 19: 25,158,927 (GRCm39) N1695I probably damaging Het
Esf1 C T 2: 140,006,139 (GRCm39) R336Q possibly damaging Het
Fam161a A G 11: 22,971,664 (GRCm39) probably null Het
Fam89a T C 8: 125,478,418 (GRCm39) E44G possibly damaging Het
Fndc3b A T 3: 27,510,634 (GRCm39) D829E probably benign Het
Fxr1 C T 3: 34,100,689 (GRCm39) T125I possibly damaging Het
Gfer T C 17: 24,914,836 (GRCm39) D69G probably damaging Het
Gpatch2l T A 12: 86,335,711 (GRCm39) S471T probably benign Het
Grm7 T G 6: 111,335,530 (GRCm39) I647S possibly damaging Het
Gsn A G 2: 35,188,807 (GRCm39) I447V probably benign Het
H2al2c C T Y: 2,599,234 (GRCm39) L46F possibly damaging Het
Hao2 A C 3: 98,784,598 (GRCm39) probably null Het
Ifitm10 T C 7: 141,882,305 (GRCm39) E155G probably benign Het
Igkv8-16 C A 6: 70,363,794 (GRCm39) W76L probably benign Het
Igsf21 A T 4: 139,834,648 (GRCm39) F75I possibly damaging Het
Ints14 T A 9: 64,871,701 (GRCm39) M13K probably damaging Het
Ipmk A T 10: 71,199,298 (GRCm39) D53V possibly damaging Het
Iqcn A T 8: 71,169,597 (GRCm39) E1229V probably benign Het
Itga8 A G 2: 12,234,906 (GRCm39) F451L possibly damaging Het
Jup A G 11: 100,272,560 (GRCm39) F284S probably damaging Het
Kctd5 T C 17: 24,292,209 (GRCm39) D65G probably benign Het
Klrc1 A T 6: 129,654,184 (GRCm39) S148T probably benign Het
Kmt5b A G 19: 3,864,147 (GRCm39) K404E probably damaging Het
Krt9 A C 11: 100,081,617 (GRCm39) M304R probably damaging Het
Krtap5-1 A T 7: 141,850,299 (GRCm39) S143T unknown Het
Kyat3 A G 3: 142,426,162 (GRCm39) N68D probably damaging Het
Kynu A G 2: 43,571,365 (GRCm39) D427G probably damaging Het
Leo1 A G 9: 75,353,278 (GRCm39) probably null Het
Loxhd1 A G 18: 77,501,892 (GRCm39) D1737G probably damaging Het
Lpo C A 11: 87,700,077 (GRCm39) L521F possibly damaging Het
Lrrk1 A G 7: 65,920,573 (GRCm39) S1477P probably damaging Het
Lrrtm1 C A 6: 77,220,584 (GRCm39) L14M probably damaging Het
Ly75 G A 2: 60,154,196 (GRCm39) R1084* probably null Het
Mcf2l A G 8: 13,060,456 (GRCm39) D764G probably benign Het
Mmut A T 17: 41,249,564 (GRCm39) M180L probably benign Het
Mrgprd A T 7: 144,876,086 (GRCm39) D319V probably benign Het
Myom3 T C 4: 135,522,490 (GRCm39) L897P possibly damaging Het
Nlrp2 T C 7: 5,320,533 (GRCm39) D868G probably damaging Het
Npy6r A G 18: 44,408,999 (GRCm39) N140S probably damaging Het
Nsmce4a T C 7: 130,141,602 (GRCm39) K196E probably benign Het
Nup88 T C 11: 70,836,080 (GRCm39) K532R probably benign Het
Or6k4 T A 1: 173,964,680 (GRCm39) Y123* probably null Het
Or8d6 T A 9: 39,853,805 (GRCm39) V83E probably benign Het
Or8g29-ps1 A T 9: 39,200,589 (GRCm39) I199N unknown Het
Pbxip1 A T 3: 89,354,735 (GRCm39) D418V possibly damaging Het
Pde2a C A 7: 101,159,151 (GRCm39) R761S possibly damaging Het
Phf10 A T 17: 15,166,575 (GRCm39) C432S probably damaging Het
Pitpnm2 T C 5: 124,259,522 (GRCm39) D1271G probably damaging Het
Plin1 A T 7: 79,373,192 (GRCm39) L259Q probably damaging Het
Pmpca G C 2: 26,285,046 (GRCm39) E424Q possibly damaging Het
Pou6f2 T A 13: 18,414,379 (GRCm39) Q132L unknown Het
Ppa2 A T 3: 133,036,199 (GRCm39) N118Y possibly damaging Het
Prickle2 T C 6: 92,387,959 (GRCm39) E537G possibly damaging Het
Prl3d1 A G 13: 27,282,684 (GRCm39) I141V possibly damaging Het
Prl8a1 A T 13: 27,758,172 (GRCm39) V179D probably damaging Het
Prr14l A G 5: 32,984,489 (GRCm39) F1669L probably benign Het
Prrg4 T A 2: 104,669,787 (GRCm39) E110V possibly damaging Het
Rfx5 C A 3: 94,866,187 (GRCm39) H495Q unknown Het
Rgl2 C T 17: 34,152,403 (GRCm39) R367W probably damaging Het
Rpe65 A G 3: 159,328,491 (GRCm39) Y433C probably damaging Het
Rpl35rt A T 1: 156,193,657 (GRCm39) I4F probably damaging Het
Rtn4rl1 C T 11: 75,156,576 (GRCm39) S336F possibly damaging Het
Scn2a A G 2: 65,578,663 (GRCm39) D1446G probably benign Het
Sdk1 C A 5: 142,031,931 (GRCm39) T1002K probably benign Het
Slc9b2 T C 3: 135,036,422 (GRCm39) S409P probably benign Het
Sowahc A G 10: 59,058,100 (GRCm39) T79A probably benign Het
Spata31h1 G A 10: 82,129,248 (GRCm39) T1254I probably benign Het
Stk35 T A 2: 129,643,513 (GRCm39) C166S probably benign Het
Tarbp2 A G 15: 102,430,922 (GRCm39) H225R probably benign Het
Tdrd12 T A 7: 35,188,648 (GRCm39) K530* probably null Het
Terf2ip A G 8: 112,744,618 (GRCm39) I312V probably benign Het
Tgfb1 T C 7: 25,391,964 (GRCm39) probably null Het
Thbs2 T C 17: 14,891,720 (GRCm39) D939G probably damaging Het
Ube4b A T 4: 149,483,067 (GRCm39) I67K probably benign Het
Ubn1 G T 16: 4,895,080 (GRCm39) V709F possibly damaging Het
Ugt2b5 T C 5: 87,276,258 (GRCm39) K339E possibly damaging Het
Vax2 T C 6: 83,714,882 (GRCm39) S266P probably damaging Het
Vmn2r108 A G 17: 20,683,038 (GRCm39) I722T probably benign Het
Vmn2r95 A G 17: 18,661,577 (GRCm39) K441R probably benign Het
Wapl C A 14: 34,458,648 (GRCm39) D903E probably benign Het
Wee1 T A 7: 109,734,001 (GRCm39) V442D probably benign Het
Zan T C 5: 137,432,358 (GRCm39) N2313S unknown Het
Other mutations in Ncapd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Ncapd2 APN 6 125,150,388 (GRCm39) missense probably benign 0.05
IGL00960:Ncapd2 APN 6 125,150,811 (GRCm39) missense probably benign
IGL01307:Ncapd2 APN 6 125,145,582 (GRCm39) missense possibly damaging 0.56
IGL01612:Ncapd2 APN 6 125,154,835 (GRCm39) missense probably benign 0.01
IGL01903:Ncapd2 APN 6 125,154,423 (GRCm39) missense probably benign
IGL01987:Ncapd2 APN 6 125,162,804 (GRCm39) splice site probably benign
IGL01998:Ncapd2 APN 6 125,146,896 (GRCm39) missense probably damaging 1.00
IGL01998:Ncapd2 APN 6 125,150,078 (GRCm39) missense probably benign 0.18
IGL02329:Ncapd2 APN 6 125,166,781 (GRCm39) missense probably damaging 0.99
IGL02550:Ncapd2 APN 6 125,154,410 (GRCm39) missense probably benign
IGL02662:Ncapd2 APN 6 125,153,694 (GRCm39) missense probably damaging 1.00
IGL02817:Ncapd2 APN 6 125,147,877 (GRCm39) critical splice donor site probably null
IGL03121:Ncapd2 APN 6 125,150,575 (GRCm39) missense probably benign 0.00
IGL03206:Ncapd2 APN 6 125,148,660 (GRCm39) missense possibly damaging 0.85
FR4548:Ncapd2 UTSW 6 125,150,559 (GRCm39) critical splice donor site probably benign
PIT4305001:Ncapd2 UTSW 6 125,160,990 (GRCm39) nonsense probably null
R0486:Ncapd2 UTSW 6 125,160,990 (GRCm39) nonsense probably null
R0635:Ncapd2 UTSW 6 125,149,999 (GRCm39) missense probably benign 0.00
R0699:Ncapd2 UTSW 6 125,146,843 (GRCm39) missense probably benign
R0746:Ncapd2 UTSW 6 125,151,227 (GRCm39) missense possibly damaging 0.50
R0893:Ncapd2 UTSW 6 125,150,445 (GRCm39) missense probably benign
R1385:Ncapd2 UTSW 6 125,150,078 (GRCm39) missense probably benign 0.18
R1513:Ncapd2 UTSW 6 125,147,955 (GRCm39) missense probably damaging 1.00
R1601:Ncapd2 UTSW 6 125,162,735 (GRCm39) missense probably damaging 1.00
R1698:Ncapd2 UTSW 6 125,145,553 (GRCm39) missense probably null 0.39
R2030:Ncapd2 UTSW 6 125,153,678 (GRCm39) missense possibly damaging 0.95
R2035:Ncapd2 UTSW 6 125,161,491 (GRCm39) missense probably benign 0.17
R2359:Ncapd2 UTSW 6 125,156,379 (GRCm39) unclassified probably benign
R3951:Ncapd2 UTSW 6 125,163,747 (GRCm39) missense probably damaging 0.98
R3952:Ncapd2 UTSW 6 125,163,747 (GRCm39) missense probably damaging 0.98
R3953:Ncapd2 UTSW 6 125,147,697 (GRCm39) missense probably damaging 0.96
R4623:Ncapd2 UTSW 6 125,150,572 (GRCm39) missense probably benign 0.04
R4630:Ncapd2 UTSW 6 125,156,196 (GRCm39) splice site probably null
R4667:Ncapd2 UTSW 6 125,161,481 (GRCm39) missense possibly damaging 0.69
R4769:Ncapd2 UTSW 6 125,162,708 (GRCm39) missense probably damaging 1.00
R4936:Ncapd2 UTSW 6 125,146,803 (GRCm39) missense probably benign 0.18
R5130:Ncapd2 UTSW 6 125,146,887 (GRCm39) missense possibly damaging 0.90
R5465:Ncapd2 UTSW 6 125,153,746 (GRCm39) missense probably damaging 0.98
R5806:Ncapd2 UTSW 6 125,158,117 (GRCm39) missense probably damaging 0.98
R5823:Ncapd2 UTSW 6 125,145,663 (GRCm39) missense probably benign 0.00
R5888:Ncapd2 UTSW 6 125,164,052 (GRCm39) missense probably damaging 1.00
R5940:Ncapd2 UTSW 6 125,145,832 (GRCm39) missense probably benign
R6198:Ncapd2 UTSW 6 125,156,286 (GRCm39) nonsense probably null
R6406:Ncapd2 UTSW 6 125,150,841 (GRCm39) missense probably benign
R6652:Ncapd2 UTSW 6 125,163,233 (GRCm39) missense probably benign 0.13
R6959:Ncapd2 UTSW 6 125,145,883 (GRCm39) missense probably benign
R6977:Ncapd2 UTSW 6 125,148,472 (GRCm39) missense probably damaging 1.00
R6982:Ncapd2 UTSW 6 125,153,699 (GRCm39) missense probably damaging 0.96
R7143:Ncapd2 UTSW 6 125,156,524 (GRCm39) missense probably benign
R7144:Ncapd2 UTSW 6 125,153,633 (GRCm39) missense probably benign 0.11
R7186:Ncapd2 UTSW 6 125,163,119 (GRCm39) missense possibly damaging 0.89
R7384:Ncapd2 UTSW 6 125,150,364 (GRCm39) missense probably benign
R8039:Ncapd2 UTSW 6 125,157,989 (GRCm39) missense probably damaging 0.98
R8047:Ncapd2 UTSW 6 125,166,762 (GRCm39) missense probably damaging 0.98
R8048:Ncapd2 UTSW 6 125,156,661 (GRCm39) nonsense probably null
R8056:Ncapd2 UTSW 6 125,148,006 (GRCm39) missense probably damaging 1.00
R8097:Ncapd2 UTSW 6 125,145,945 (GRCm39) missense possibly damaging 0.78
R8489:Ncapd2 UTSW 6 125,150,745 (GRCm39) missense probably damaging 0.98
R8496:Ncapd2 UTSW 6 125,147,127 (GRCm39) missense probably damaging 0.99
R8755:Ncapd2 UTSW 6 125,148,817 (GRCm39) missense possibly damaging 0.69
R8776:Ncapd2 UTSW 6 125,154,476 (GRCm39) missense probably benign
R8776-TAIL:Ncapd2 UTSW 6 125,154,476 (GRCm39) missense probably benign
R9015:Ncapd2 UTSW 6 125,145,285 (GRCm39) unclassified probably benign
R9042:Ncapd2 UTSW 6 125,156,301 (GRCm39) missense probably benign
R9358:Ncapd2 UTSW 6 125,163,106 (GRCm39) missense probably benign 0.00
R9437:Ncapd2 UTSW 6 125,153,655 (GRCm39) missense probably damaging 0.99
RF045:Ncapd2 UTSW 6 125,156,199 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGGAATCCAACGTCACATGGAG -3'
(R):5'- ACCGCCTTTTGGAGAATCCC -3'

Sequencing Primer
(F):5'- TGGAGAAAGGACCCCTAACTTC -3'
(R):5'- TTGGAGAATCCCACCATTAGTC -3'
Posted On 2019-06-26