Mutagenetix > Incidental Mutation

Incidental Mutation 'R7203:Itga8'

560739

Institutional Source

Beutler Lab

Gene Symbol

Itga8

Ensembl Gene

ENSMUSG00000026768

Gene Name

integrin alpha 8

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.898) question?

Stock #

R7203 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

12106632-12301922 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 12230095 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 451 (F451L)

Ref Sequence

ENSEMBL: ENSMUSP00000028106 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]

AlphaFold

A2ARA8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028106
AA Change: F451L

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: F451L

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART
SCOP:d1m1xa2	643	780	2e-46	SMART
SCOP:d1m1xa3	784	1000	2e-80	SMART
transmembrane domain	1011	1033	N/A	INTRINSIC
Pfam:Integrin_alpha	1034	1048	2.5e-7	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172791
AA Change: F451L

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768
AA Change: F451L

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (108/108)

MGI Phenotype

FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 108 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930544G11Rik	T	C	6: 65,953,333	V184A	probably benign	Het
4932415D10Rik	G	A	10: 82,293,414	T1254I	probably benign	Het
Aars2	A	G	17: 45,516,571	Y513C	probably damaging	Het
Ackr2	G	A	9: 121,908,967	C136Y	probably damaging	Het
Aldh1l1	A	G	6: 90,570,800	K414R	probably benign	Het
Arl9	A	G	5: 77,007,271	Y83C	possibly damaging	Het
Atp10a	G	T	7: 58,786,473	R337L	probably benign	Het
Atp6v1g3	A	T	1: 138,287,800	Q66L	probably damaging	Het
Atp7b	A	T	8: 21,997,335	N1321K	probably damaging	Het
Axdnd1	A	T	1: 156,382,389	M437K	probably damaging	Het
Bap1	C	A	14: 31,254,169	P147Q	probably damaging	Het
Bicd1	C	T	6: 149,512,905	T372I	possibly damaging	Het
Brix1	T	C	15: 10,483,292		probably null	Het
Btrc	A	G	19: 45,513,528		probably null	Het
C130050O18Rik	A	C	5: 139,414,374	I61L	probably benign	Het
Cfap161	A	G	7: 83,776,050	S278P	probably damaging	Het
Cgnl1	T	C	9: 71,724,533	D512G	possibly damaging	Het
Chat	T	C	14: 32,419,057	D461G	probably damaging	Het
Chl1	T	A	6: 103,691,674	V456D	probably benign	Het
Cib1	T	C	7: 80,232,372	T20A	possibly damaging	Het
Cubn	T	G	2: 13,351,003	H1806P	probably benign	Het
Dapk1	T	A	13: 60,696,335	V56E	possibly damaging	Het
Dennd4a	A	G	9: 64,896,474	N1032D	probably benign	Het
Dlg5	T	A	14: 24,138,655	E1756V	probably damaging	Het
Dnah1	T	C	14: 31,274,382	T2666A	probably benign	Het
Dnah11	A	T	12: 118,045,522	I2135N	possibly damaging	Het
Dnah6	T	A	6: 73,173,545	E745V	probably benign	Het
Dock8	A	T	19: 25,181,563	N1695I	probably damaging	Het
Esf1	C	T	2: 140,164,219	R336Q	possibly damaging	Het
Fam161a	A	G	11: 23,021,664		probably null	Het
Fam89a	T	C	8: 124,751,679	E44G	possibly damaging	Het
Fndc3b	A	T	3: 27,456,485	D829E	probably benign	Het
Fxr1	C	T	3: 34,046,540	T125I	possibly damaging	Het
Gfer	T	C	17: 24,695,862	D69G	probably damaging	Het
Gm16486	A	T	8: 70,716,948	E1229V	probably benign	Het
Gm2000	A	T	1: 156,366,087	I4F	probably damaging	Het
Gpatch2l	T	A	12: 86,288,937	S471T	probably benign	Het
Grm7	T	G	6: 111,358,569	I647S	possibly damaging	Het
Gsn	A	G	2: 35,298,795	I447V	probably benign	Het
H2al2c	C	T	Y: 2,599,234	L46F	possibly damaging	Het
Hao2	A	C	3: 98,877,282		probably null	Het
Ifitm10	T	C	7: 142,328,568	E155G	probably benign	Het
Igkv8-16	C	A	6: 70,386,810	W76L	probably benign	Het
Igsf21	A	T	4: 140,107,337	F75I	possibly damaging	Het
Ints14	T	A	9: 64,964,419	M13K	probably damaging	Het
Ipmk	A	T	10: 71,363,468	D53V	possibly damaging	Het
Jup	A	G	11: 100,381,734	F284S	probably damaging	Het
Kctd5	T	C	17: 24,073,235	D65G	probably benign	Het
Klrc1	A	T	6: 129,677,221	S148T	probably benign	Het
Kmt5b	A	G	19: 3,814,147	K404E	probably damaging	Het
Krt9	A	C	11: 100,190,791	M304R	probably damaging	Het
Krtap5-1	A	T	7: 142,296,562	S143T	unknown	Het
Kyat3	A	G	3: 142,720,401	N68D	probably damaging	Het
Kynu	A	G	2: 43,681,353	D427G	probably damaging	Het
Leo1	A	G	9: 75,445,996		probably null	Het
Loxhd1	A	G	18: 77,414,196	D1737G	probably damaging	Het
Lpo	C	A	11: 87,809,251	L521F	possibly damaging	Het
Lrrk1	A	G	7: 66,270,825	S1477P	probably damaging	Het
Lrrtm1	C	A	6: 77,243,601	L14M	probably damaging	Het
Ly75	G	A	2: 60,323,852	R1084*	probably null	Het
Mcf2l	A	G	8: 13,010,456	D764G	probably benign	Het
Mrgprd	A	T	7: 145,322,349	D319V	probably benign	Het
Mut	A	T	17: 40,938,673	M180L	probably benign	Het
Myom3	T	C	4: 135,795,179	L897P	possibly damaging	Het
Ncapd2	A	T	6: 125,184,328	M247K	possibly damaging	Het
Nlrp2	T	C	7: 5,317,534	D868G	probably damaging	Het
Npy6r	A	G	18: 44,275,932	N140S	probably damaging	Het
Nsmce4a	T	C	7: 130,539,872	K196E	probably benign	Het
Nup88	T	C	11: 70,945,254	K532R	probably benign	Het
Olfr424	T	A	1: 174,137,114	Y123*	probably null	Het
Olfr947-ps1	A	T	9: 39,289,293	I199N	unknown	Het
Olfr974	T	A	9: 39,942,509	V83E	probably benign	Het
Pbxip1	A	T	3: 89,447,428	D418V	possibly damaging	Het
Pde2a	C	A	7: 101,509,944	R761S	possibly damaging	Het
Phf10	A	T	17: 14,946,313	C432S	probably damaging	Het
Pitpnm2	T	C	5: 124,121,459	D1271G	probably damaging	Het
Plin1	A	T	7: 79,723,444	L259Q	probably damaging	Het
Pmpca	G	C	2: 26,395,034	E424Q	possibly damaging	Het
Pou6f2	T	A	13: 18,239,794	Q132L	unknown	Het
Ppa2	A	T	3: 133,330,438	N118Y	possibly damaging	Het
Prickle2	T	C	6: 92,410,978	E537G	possibly damaging	Het
Prl3d1	A	G	13: 27,098,701	I141V	possibly damaging	Het
Prl8a1	A	T	13: 27,574,189	V179D	probably damaging	Het
Prr14l	A	G	5: 32,827,145	F1669L	probably benign	Het
Prrg4	T	A	2: 104,839,442	E110V	possibly damaging	Het
Rfx5	C	A	3: 94,958,876	H495Q	unknown	Het
Rgl2	C	T	17: 33,933,429	R367W	probably damaging	Het
Rpe65	A	G	3: 159,622,854	Y433C	probably damaging	Het
Rtn4rl1	C	T	11: 75,265,750	S336F	possibly damaging	Het
Scn2a	A	G	2: 65,748,319	D1446G	probably benign	Het
Sdk1	C	A	5: 142,046,176	T1002K	probably benign	Het
Slc9b2	T	C	3: 135,330,661	S409P	probably benign	Het
Sowahc	A	G	10: 59,222,278	T79A	probably benign	Het
Stk35	T	A	2: 129,801,593	C166S	probably benign	Het
Tarbp2	A	G	15: 102,522,487	H225R	probably benign	Het
Tdrd12	T	A	7: 35,489,223	K530*	probably null	Het
Terf2ip	A	G	8: 112,017,986	I312V	probably benign	Het
Tgfb1	T	C	7: 25,692,539		probably null	Het
Thbs2	T	C	17: 14,671,458	D939G	probably damaging	Het
Ube4b	A	T	4: 149,398,610	I67K	probably benign	Het
Ubn1	G	T	16: 5,077,216	V709F	possibly damaging	Het
Ugt2b5	T	C	5: 87,128,399	K339E	possibly damaging	Het
Vax2	T	C	6: 83,737,900	S266P	probably damaging	Het
Vmn2r108	A	G	17: 20,462,776	I722T	probably benign	Het
Vmn2r95	A	G	17: 18,441,315	K441R	probably benign	Het
Wapl	C	A	14: 34,736,691	D903E	probably benign	Het
Wee1	T	A	7: 110,134,794	V442D	probably benign	Het
Zan	T	C	5: 137,434,096	N2313S	unknown	Het

Other mutations in Itga8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00806:Itga8	APN	2	12255966	nonsense	probably null
IGL00820:Itga8	APN	2	12232892	missense	possibly damaging	0.85
IGL01409:Itga8	APN	2	12191714	missense	probably benign
IGL01508:Itga8	APN	2	12232802	missense	possibly damaging	0.67
IGL01585:Itga8	APN	2	12160312	splice site	probably benign
IGL01590:Itga8	APN	2	12160333	missense	probably damaging	1.00
IGL01743:Itga8	APN	2	12265333	missense	probably benign	0.04
IGL02634:Itga8	APN	2	12140478	missense	possibly damaging	0.55
IGL02805:Itga8	APN	2	12189480	missense	possibly damaging	0.83
IGL03200:Itga8	APN	2	12191199	missense	probably benign	0.00
IGL03218:Itga8	APN	2	12111025	missense	possibly damaging	0.77
IGL03248:Itga8	APN	2	12132516	missense	probably benign	0.20
PIT4576001:Itga8	UTSW	2	12230092	missense	probably benign	0.19
R0196:Itga8	UTSW	2	12204729	critical splice donor site	probably null
R0356:Itga8	UTSW	2	12182721	missense	possibly damaging	0.73
R0466:Itga8	UTSW	2	12232886	missense	probably damaging	1.00
R0530:Itga8	UTSW	2	12191816	missense	probably damaging	0.99
R0715:Itga8	UTSW	2	12191242	splice site	probably benign
R0800:Itga8	UTSW	2	12193551	missense	possibly damaging	0.95
R0881:Itga8	UTSW	2	12262192	splice site	probably null
R1675:Itga8	UTSW	2	12200163	missense	probably damaging	0.99
R1758:Itga8	UTSW	2	12265333	missense	possibly damaging	0.83
R1939:Itga8	UTSW	2	12300846	missense	probably damaging	1.00
R2187:Itga8	UTSW	2	12194420	missense	possibly damaging	0.60
R2295:Itga8	UTSW	2	12182709	missense	probably benign	0.38
R2356:Itga8	UTSW	2	12200141	missense	probably benign
R2371:Itga8	UTSW	2	12253466	missense	probably damaging	1.00
R2412:Itga8	UTSW	2	12301715	missense	probably benign
R2440:Itga8	UTSW	2	12178680	missense	possibly damaging	0.70
R2848:Itga8	UTSW	2	12160404	missense	probably damaging	0.98
R3730:Itga8	UTSW	2	12193510	missense	possibly damaging	0.92
R3933:Itga8	UTSW	2	12189519	missense	probably benign
R3982:Itga8	UTSW	2	12300963	missense	possibly damaging	0.92
R4513:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4514:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4660:Itga8	UTSW	2	12265258	missense	probably damaging	1.00
R4890:Itga8	UTSW	2	12193291	splice site	probably benign
R5533:Itga8	UTSW	2	12160350	missense	possibly damaging	0.90
R5619:Itga8	UTSW	2	12265328	missense	probably damaging	1.00
R5720:Itga8	UTSW	2	12111087	missense	probably damaging	0.99
R5749:Itga8	UTSW	2	12262078	missense	probably damaging	1.00
R5930:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R5954:Itga8	UTSW	2	12132486	missense	probably damaging	0.99
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6211:Itga8	UTSW	2	12193509	missense	probably damaging	1.00
R6337:Itga8	UTSW	2	12253469	nonsense	probably null
R6442:Itga8	UTSW	2	12230143	missense	probably benign	0.00
R6491:Itga8	UTSW	2	12204776	missense	probably damaging	1.00
R6543:Itga8	UTSW	2	12301644	missense	probably damaging	0.99
R6574:Itga8	UTSW	2	12230161	missense	probably benign	0.17
R6760:Itga8	UTSW	2	12301640	missense	probably damaging	1.00
R6858:Itga8	UTSW	2	12200081	missense	probably benign	0.00
R6943:Itga8	UTSW	2	12155371	critical splice donor site	probably null
R7048:Itga8	UTSW	2	12111084	missense	probably damaging	0.99
R7266:Itga8	UTSW	2	12232901	missense	probably damaging	1.00
R7323:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R7540:Itga8	UTSW	2	12111037	missense	possibly damaging	0.82
R7637:Itga8	UTSW	2	12109187	missense	probably damaging	1.00
R7748:Itga8	UTSW	2	12230239	missense	possibly damaging	0.80
R7848:Itga8	UTSW	2	12191737	missense	probably damaging	0.99
R8031:Itga8	UTSW	2	12155486	missense	probably benign
R8077:Itga8	UTSW	2	12242433	missense	probably benign	0.09
R8757:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8759:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8772:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8773:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8808:Itga8	UTSW	2	12132517	nonsense	probably null
R8898:Itga8	UTSW	2	12140395	missense	probably benign	0.05
R8962:Itga8	UTSW	2	12191234	missense	possibly damaging	0.94
R9056:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R9155:Itga8	UTSW	2	12189519	missense	probably benign
R9354:Itga8	UTSW	2	12232857	missense	possibly damaging	0.94
R9563:Itga8	UTSW	2	12160408	missense	possibly damaging	0.83
R9589:Itga8	UTSW	2	12232890	missense	probably damaging	1.00
R9663:Itga8	UTSW	2	12191769	missense	probably benign	0.00
Z1176:Itga8	UTSW	2	12247518	missense	probably damaging	1.00
Z1176:Itga8	UTSW	2	12262136	missense	probably benign	0.01
Z1176:Itga8	UTSW	2	12301832	start gained	probably benign
Z1177:Itga8	UTSW	2	12300933	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- AGAGCCTGTGCCATGTTAAACTTG -3'
(R):5'- ATTTGGACCCTGGGGCATTG -3'

Sequencing Primer
(F):5'- GTGCCATGTTAAACTTGACCTTC -3'
(R):5'- TCTCTCTTCCTTTCTTTTCAAATCTG -3'

Posted On

2019-06-26