Incidental Mutation 'R7203:Itga8'
ID560739
Institutional Source Beutler Lab
Gene Symbol Itga8
Ensembl Gene ENSMUSG00000026768
Gene Nameintegrin alpha 8
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.834) question?
Stock #R7203 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location12106632-12301922 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12230095 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 451 (F451L)
Ref Sequence ENSEMBL: ENSMUSP00000028106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028106
AA Change: F451L

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: F451L

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
SCOP:d1m1xa2 643 780 2e-46 SMART
SCOP:d1m1xa3 784 1000 2e-80 SMART
transmembrane domain 1011 1033 N/A INTRINSIC
Pfam:Integrin_alpha 1034 1048 2.5e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172791
AA Change: F451L

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768
AA Change: F451L

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (108/108)
MGI Phenotype FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544G11Rik T C 6: 65,953,333 V184A probably benign Het
4932415D10Rik G A 10: 82,293,414 T1254I probably benign Het
Aars2 A G 17: 45,516,571 Y513C probably damaging Het
Ackr2 G A 9: 121,908,967 C136Y probably damaging Het
Aldh1l1 A G 6: 90,570,800 K414R probably benign Het
Arl9 A G 5: 77,007,271 Y83C possibly damaging Het
Atp10a G T 7: 58,786,473 R337L probably benign Het
Atp6v1g3 A T 1: 138,287,800 Q66L probably damaging Het
Atp7b A T 8: 21,997,335 N1321K probably damaging Het
Axdnd1 A T 1: 156,382,389 M437K probably damaging Het
Bap1 C A 14: 31,254,169 P147Q probably damaging Het
Bicd1 C T 6: 149,512,905 T372I possibly damaging Het
Brix1 T C 15: 10,483,292 probably null Het
Btrc A G 19: 45,513,528 probably null Het
C130050O18Rik A C 5: 139,414,374 I61L probably benign Het
Cfap161 A G 7: 83,776,050 S278P probably damaging Het
Cgnl1 T C 9: 71,724,533 D512G possibly damaging Het
Chat T C 14: 32,419,057 D461G probably damaging Het
Chl1 T A 6: 103,691,674 V456D probably benign Het
Cib1 T C 7: 80,232,372 T20A possibly damaging Het
Cubn T G 2: 13,351,003 H1806P probably benign Het
Dapk1 T A 13: 60,696,335 V56E possibly damaging Het
Dennd4a A G 9: 64,896,474 N1032D probably benign Het
Dlg5 T A 14: 24,138,655 E1756V probably damaging Het
Dnah1 T C 14: 31,274,382 T2666A probably benign Het
Dnah11 A T 12: 118,045,522 I2135N possibly damaging Het
Dnah6 T A 6: 73,173,545 E745V probably benign Het
Dock8 A T 19: 25,181,563 N1695I probably damaging Het
Esf1 C T 2: 140,164,219 R336Q possibly damaging Het
Fam161a A G 11: 23,021,664 probably null Het
Fam89a T C 8: 124,751,679 E44G possibly damaging Het
Fndc3b A T 3: 27,456,485 D829E probably benign Het
Fxr1 C T 3: 34,046,540 T125I possibly damaging Het
Gfer T C 17: 24,695,862 D69G probably damaging Het
Gm16486 A T 8: 70,716,948 E1229V probably benign Het
Gm2000 A T 1: 156,366,087 I4F probably damaging Het
Gpatch2l T A 12: 86,288,937 S471T probably benign Het
Grm7 T G 6: 111,358,569 I647S possibly damaging Het
Gsn A G 2: 35,298,795 I447V probably benign Het
H2al2c C T Y: 2,599,234 L46F possibly damaging Het
Hao2 A C 3: 98,877,282 probably null Het
Ifitm10 T C 7: 142,328,568 E155G probably benign Het
Igkv8-16 C A 6: 70,386,810 W76L probably benign Het
Igsf21 A T 4: 140,107,337 F75I possibly damaging Het
Ints14 T A 9: 64,964,419 M13K probably damaging Het
Ipmk A T 10: 71,363,468 D53V possibly damaging Het
Jup A G 11: 100,381,734 F284S probably damaging Het
Kctd5 T C 17: 24,073,235 D65G probably benign Het
Klrc1 A T 6: 129,677,221 S148T probably benign Het
Kmt5b A G 19: 3,814,147 K404E probably damaging Het
Krt9 A C 11: 100,190,791 M304R probably damaging Het
Krtap5-1 A T 7: 142,296,562 S143T unknown Het
Kyat3 A G 3: 142,720,401 N68D probably damaging Het
Kynu A G 2: 43,681,353 D427G probably damaging Het
Leo1 A G 9: 75,445,996 probably null Het
Loxhd1 A G 18: 77,414,196 D1737G probably damaging Het
Lpo C A 11: 87,809,251 L521F possibly damaging Het
Lrrk1 A G 7: 66,270,825 S1477P probably damaging Het
Lrrtm1 C A 6: 77,243,601 L14M probably damaging Het
Ly75 G A 2: 60,323,852 R1084* probably null Het
Mcf2l A G 8: 13,010,456 D764G probably benign Het
Mrgprd A T 7: 145,322,349 D319V probably benign Het
Mut A T 17: 40,938,673 M180L probably benign Het
Myom3 T C 4: 135,795,179 L897P possibly damaging Het
Ncapd2 A T 6: 125,184,328 M247K possibly damaging Het
Nlrp2 T C 7: 5,317,534 D868G probably damaging Het
Npy6r A G 18: 44,275,932 N140S probably damaging Het
Nsmce4a T C 7: 130,539,872 K196E probably benign Het
Nup88 T C 11: 70,945,254 K532R probably benign Het
Olfr424 T A 1: 174,137,114 Y123* probably null Het
Olfr947-ps1 A T 9: 39,289,293 I199N unknown Het
Olfr974 T A 9: 39,942,509 V83E probably benign Het
Pbxip1 A T 3: 89,447,428 D418V possibly damaging Het
Pde2a C A 7: 101,509,944 R761S possibly damaging Het
Phf10 A T 17: 14,946,313 C432S probably damaging Het
Pitpnm2 T C 5: 124,121,459 D1271G probably damaging Het
Plin1 A T 7: 79,723,444 L259Q probably damaging Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Pou6f2 T A 13: 18,239,794 Q132L unknown Het
Ppa2 A T 3: 133,330,438 N118Y possibly damaging Het
Prickle2 T C 6: 92,410,978 E537G possibly damaging Het
Prl3d1 A G 13: 27,098,701 I141V possibly damaging Het
Prl8a1 A T 13: 27,574,189 V179D probably damaging Het
Prr14l A G 5: 32,827,145 F1669L probably benign Het
Prrg4 T A 2: 104,839,442 E110V possibly damaging Het
Rfx5 C A 3: 94,958,876 H495Q unknown Het
Rgl2 C T 17: 33,933,429 R367W probably damaging Het
Rpe65 A G 3: 159,622,854 Y433C probably damaging Het
Rtn4rl1 C T 11: 75,265,750 S336F possibly damaging Het
Scn2a A G 2: 65,748,319 D1446G probably benign Het
Sdk1 C A 5: 142,046,176 T1002K probably benign Het
Slc9b2 T C 3: 135,330,661 S409P probably benign Het
Sowahc A G 10: 59,222,278 T79A probably benign Het
Stk35 T A 2: 129,801,593 C166S probably benign Het
Tarbp2 A G 15: 102,522,487 H225R probably benign Het
Tdrd12 T A 7: 35,489,223 K530* probably null Het
Terf2ip A G 8: 112,017,986 I312V probably benign Het
Tgfb1 T C 7: 25,692,539 probably null Het
Thbs2 T C 17: 14,671,458 D939G probably damaging Het
Ube4b A T 4: 149,398,610 I67K probably benign Het
Ubn1 G T 16: 5,077,216 V709F possibly damaging Het
Ugt2b5 T C 5: 87,128,399 K339E possibly damaging Het
Vax2 T C 6: 83,737,900 S266P probably damaging Het
Vmn2r108 A G 17: 20,462,776 I722T probably benign Het
Vmn2r95 A G 17: 18,441,315 K441R probably benign Het
Wapl C A 14: 34,736,691 D903E probably benign Het
Wee1 T A 7: 110,134,794 V442D probably benign Het
Zan T C 5: 137,434,096 N2313S unknown Het
Other mutations in Itga8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Itga8 APN 2 12255966 nonsense probably null
IGL00820:Itga8 APN 2 12232892 missense possibly damaging 0.85
IGL01409:Itga8 APN 2 12191714 missense probably benign
IGL01508:Itga8 APN 2 12232802 missense possibly damaging 0.67
IGL01585:Itga8 APN 2 12160312 splice site probably benign
IGL01590:Itga8 APN 2 12160333 missense probably damaging 1.00
IGL01743:Itga8 APN 2 12265333 missense probably benign 0.04
IGL02634:Itga8 APN 2 12140478 missense possibly damaging 0.55
IGL02805:Itga8 APN 2 12189480 missense possibly damaging 0.83
IGL03200:Itga8 APN 2 12191199 missense probably benign 0.00
IGL03218:Itga8 APN 2 12111025 missense possibly damaging 0.77
IGL03248:Itga8 APN 2 12132516 missense probably benign 0.20
PIT4576001:Itga8 UTSW 2 12230092 missense probably benign 0.19
R0196:Itga8 UTSW 2 12204729 critical splice donor site probably null
R0356:Itga8 UTSW 2 12182721 missense possibly damaging 0.73
R0466:Itga8 UTSW 2 12232886 missense probably damaging 1.00
R0530:Itga8 UTSW 2 12191816 missense probably damaging 0.99
R0715:Itga8 UTSW 2 12191242 splice site probably benign
R0800:Itga8 UTSW 2 12193551 missense possibly damaging 0.95
R0881:Itga8 UTSW 2 12262192 splice site probably null
R1675:Itga8 UTSW 2 12200163 missense probably damaging 0.99
R1758:Itga8 UTSW 2 12265333 missense possibly damaging 0.83
R1939:Itga8 UTSW 2 12300846 missense probably damaging 1.00
R2187:Itga8 UTSW 2 12194420 missense possibly damaging 0.60
R2295:Itga8 UTSW 2 12182709 missense probably benign 0.38
R2356:Itga8 UTSW 2 12200141 missense probably benign
R2371:Itga8 UTSW 2 12253466 missense probably damaging 1.00
R2412:Itga8 UTSW 2 12301715 missense probably benign
R2440:Itga8 UTSW 2 12178680 missense possibly damaging 0.70
R2848:Itga8 UTSW 2 12160404 missense probably damaging 0.98
R3730:Itga8 UTSW 2 12193510 missense possibly damaging 0.92
R3933:Itga8 UTSW 2 12189519 missense probably benign
R3982:Itga8 UTSW 2 12300963 missense possibly damaging 0.92
R4513:Itga8 UTSW 2 12182736 missense probably benign 0.01
R4514:Itga8 UTSW 2 12182736 missense probably benign 0.01
R4660:Itga8 UTSW 2 12265258 missense probably damaging 1.00
R4890:Itga8 UTSW 2 12193291 splice site probably benign
R5533:Itga8 UTSW 2 12160350 missense possibly damaging 0.90
R5619:Itga8 UTSW 2 12265328 missense probably damaging 1.00
R5720:Itga8 UTSW 2 12111087 missense probably damaging 0.99
R5749:Itga8 UTSW 2 12262078 missense probably damaging 1.00
R5930:Itga8 UTSW 2 12230208 missense possibly damaging 0.84
R5954:Itga8 UTSW 2 12132486 missense probably damaging 0.99
R6035:Itga8 UTSW 2 12191714 missense probably benign
R6035:Itga8 UTSW 2 12191714 missense probably benign
R6211:Itga8 UTSW 2 12193509 missense probably damaging 1.00
R6337:Itga8 UTSW 2 12253469 nonsense probably null
R6442:Itga8 UTSW 2 12230143 missense probably benign 0.00
R6491:Itga8 UTSW 2 12204776 missense probably damaging 1.00
R6543:Itga8 UTSW 2 12301644 missense probably damaging 0.99
R6574:Itga8 UTSW 2 12230161 missense probably benign 0.17
R6760:Itga8 UTSW 2 12301640 missense probably damaging 1.00
R6858:Itga8 UTSW 2 12200081 missense probably benign 0.00
R6943:Itga8 UTSW 2 12155371 critical splice donor site probably null
R7048:Itga8 UTSW 2 12111084 missense probably damaging 0.99
R7266:Itga8 UTSW 2 12232901 missense probably damaging 1.00
R7323:Itga8 UTSW 2 12262129 missense probably damaging 1.00
R7540:Itga8 UTSW 2 12111037 missense possibly damaging 0.82
R7637:Itga8 UTSW 2 12109187 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCCTGTGCCATGTTAAACTTG -3'
(R):5'- ATTTGGACCCTGGGGCATTG -3'

Sequencing Primer
(F):5'- GTGCCATGTTAAACTTGACCTTC -3'
(R):5'- TCTCTCTTCCTTTCTTTTCAAATCTG -3'
Posted On2019-06-26