Incidental Mutation 'R0579:Hmgcs2'
ID56349
Institutional Source Beutler Lab
Gene Symbol Hmgcs2
Ensembl Gene ENSMUSG00000027875
Gene Name3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2
SynonymsmHS
MMRRC Submission 038769-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R0579 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location98280435-98310738 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98290948 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 56 (I56F)
Ref Sequence ENSEMBL: ENSMUSP00000113296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090746] [ENSMUST00000120541]
Predicted Effect probably damaging
Transcript: ENSMUST00000090746
AA Change: I56F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088249
Gene: ENSMUSG00000027875
AA Change: I56F

DomainStartEndE-ValueType
Pfam:HMG_CoA_synt_N 50 223 2.9e-111 PFAM
Pfam:HMG_CoA_synt_C 224 506 6.6e-131 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120541
AA Change: I56F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113296
Gene: ENSMUSG00000027875
AA Change: I56F

DomainStartEndE-ValueType
Pfam:HMG_CoA_synt_N 50 223 7.2e-108 PFAM
Pfam:HMG_CoA_synt_C 224 506 1.8e-131 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196040
Meta Mutation Damage Score 0.9051 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency 89% (34/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the HMG-CoA synthase family. It is a mitochondrial enzyme that catalyzes the first reaction of ketogenesis, a metabolic pathway that provides lipid-derived energy for various organs during times of carbohydrate deprivation, such as fasting. Mutations in this gene are associated with HMG-CoA synthase deficiency. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik GCC GC 13: 59,691,598 probably null Het
Abcf3 G A 16: 20,550,648 R260Q probably benign Het
Abcg3 A G 5: 104,974,103 V136A probably damaging Het
Acr C G 15: 89,569,475 H72Q probably damaging Het
Ambra1 A G 2: 91,824,465 N783S possibly damaging Het
Cd300ld2 A G 11: 115,012,299 F240S probably benign Het
Cep83 A G 10: 94,749,053 D340G possibly damaging Het
Crybg2 T A 4: 134,072,738 I403N probably damaging Het
Dnah14 T A 1: 181,744,747 M2881K possibly damaging Het
Erbb4 T C 1: 68,042,462 M1138V probably benign Het
Evi5 A G 5: 107,821,709 V112A probably benign Het
F2r A G 13: 95,618,349 V9A probably benign Het
Flot1 C A 17: 35,831,008 S337R probably benign Het
Glt28d2 G A 3: 85,872,133 T11I probably damaging Het
Gm19345 A G 7: 19,854,976 probably benign Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Ifna9 T A 4: 88,592,271 T39S possibly damaging Het
Il21 T G 3: 37,227,774 K74Q possibly damaging Het
Itpripl1 G T 2: 127,141,091 Y370* probably null Het
Kif24 G A 4: 41,393,706 P1056S probably damaging Het
L2hgdh A T 12: 69,701,272 probably benign Het
Lipo2 A T 19: 33,746,898 L156Q probably damaging Het
Nlrp4c T A 7: 6,060,845 M84K probably benign Het
Npy4r G A 14: 34,146,683 T216I probably benign Het
Olfr109 T C 17: 37,466,347 V47A probably benign Het
Olfr802 A T 10: 129,682,237 C167* probably null Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pafah1b2 T C 9: 45,968,713 E222G probably benign Het
Pop1 T A 15: 34,509,969 D406E possibly damaging Het
Proser1 A G 3: 53,467,151 Y32C probably damaging Het
Ptprj C A 2: 90,436,569 probably null Het
Slc1a3 T A 15: 8,688,309 I100F probably damaging Het
Slc25a22 T C 7: 141,431,359 D176G probably damaging Het
Stard7 T C 2: 127,284,553 V99A probably damaging Het
Stk33 C T 7: 109,325,697 V184I probably damaging Het
Timmdc1 A G 16: 38,522,383 L51P probably benign Het
Tppp T C 13: 74,021,233 S31P probably benign Het
Upf2 A T 2: 5,988,429 R599W unknown Het
Vav1 G T 17: 57,279,271 W25L probably benign Het
Other mutations in Hmgcs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0657:Hmgcs2 UTSW 3 98291053 missense probably benign
R0724:Hmgcs2 UTSW 3 98297001 nonsense probably null
R2024:Hmgcs2 UTSW 3 98299214 missense probably damaging 1.00
R2109:Hmgcs2 UTSW 3 98297021 nonsense probably null
R2202:Hmgcs2 UTSW 3 98291183 missense probably damaging 1.00
R2203:Hmgcs2 UTSW 3 98291183 missense probably damaging 1.00
R2204:Hmgcs2 UTSW 3 98291183 missense probably damaging 1.00
R2205:Hmgcs2 UTSW 3 98291183 missense probably damaging 1.00
R3758:Hmgcs2 UTSW 3 98291090 missense probably damaging 1.00
R3779:Hmgcs2 UTSW 3 98299112 splice site probably benign
R3958:Hmgcs2 UTSW 3 98297477 missense possibly damaging 0.48
R3959:Hmgcs2 UTSW 3 98297477 missense possibly damaging 0.48
R3960:Hmgcs2 UTSW 3 98297477 missense possibly damaging 0.48
R3962:Hmgcs2 UTSW 3 98291038 missense possibly damaging 0.91
R4788:Hmgcs2 UTSW 3 98291084 missense probably damaging 1.00
R5102:Hmgcs2 UTSW 3 98280470 start gained probably benign
R5708:Hmgcs2 UTSW 3 98291162 missense probably damaging 1.00
R5742:Hmgcs2 UTSW 3 98297516 missense probably benign
R7268:Hmgcs2 UTSW 3 98297480 missense probably benign 0.02
R7294:Hmgcs2 UTSW 3 98290895 missense probably benign 0.09
R7503:Hmgcs2 UTSW 3 98302624 missense probably damaging 1.00
R7767:Hmgcs2 UTSW 3 98291266 missense probably damaging 1.00
R8043:Hmgcs2 UTSW 3 98291128 missense probably damaging 1.00
Z1176:Hmgcs2 UTSW 3 98290945 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTGAAAGTCGGACAGACTACCATAC -3'
(R):5'- AGCTTTGTGCGTTCCATCAGCC -3'

Sequencing Primer
(F):5'- acataccttcaaaacatactaagacg -3'
(R):5'- AGCCTCTGTACCACTGTCAG -3'
Posted On2013-07-11