Incidental Mutation 'R7326:Pnkp'
ID568905
Institutional Source Beutler Lab
Gene Symbol Pnkp
Ensembl Gene ENSMUSG00000002963
Gene Namepolynucleotide kinase 3'- phosphatase
SynonymsPNK, 1810009G08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R7326 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location44857139-44862992 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44859734 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 169 (F169L)
Ref Sequence ENSEMBL: ENSMUSP00000003044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003044] [ENSMUST00000046575] [ENSMUST00000054343] [ENSMUST00000098478] [ENSMUST00000107876] [ENSMUST00000107880] [ENSMUST00000107882] [ENSMUST00000107885] [ENSMUST00000123015] [ENSMUST00000124168] [ENSMUST00000139003] [ENSMUST00000154968] [ENSMUST00000155050] [ENSMUST00000200892] [ENSMUST00000201882] [ENSMUST00000202646] [ENSMUST00000207363] [ENSMUST00000209018]
Predicted Effect probably damaging
Transcript: ENSMUST00000003044
AA Change: F169L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000003044
Gene: ENSMUSG00000002963
AA Change: F169L

DomainStartEndE-ValueType
PDB:1YJM|C 1 110 4e-62 PDB
SCOP:d1lgpa_ 8 114 5e-12 SMART
Blast:FHA 31 74 1e-10 BLAST
low complexity region 116 134 N/A INTRINSIC
Pfam:PNK3P 165 327 9.3e-58 PFAM
low complexity region 350 364 N/A INTRINSIC
Pfam:AAA_33 366 488 1.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000046575
SMART Domains Protein: ENSMUSP00000035281
Gene: ENSMUSG00000038502

DomainStartEndE-ValueType
low complexity region 10 50 N/A INTRINSIC
low complexity region 64 82 N/A INTRINSIC
Pfam:Med25 89 238 1.7e-58 PFAM
Pfam:Med25 254 399 4.2e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054343
SMART Domains Protein: ENSMUSP00000049764
Gene: ENSMUSG00000011096

DomainStartEndE-ValueType
low complexity region 33 60 N/A INTRINSIC
low complexity region 66 101 N/A INTRINSIC
low complexity region 102 116 N/A INTRINSIC
low complexity region 161 180 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098478
AA Change: F169L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096078
Gene: ENSMUSG00000002963
AA Change: F169L

DomainStartEndE-ValueType
PDB:1YJM|C 1 110 2e-62 PDB
SCOP:d1lgpa_ 8 114 5e-12 SMART
Blast:FHA 31 74 1e-10 BLAST
low complexity region 116 134 N/A INTRINSIC
Pfam:PNK3P 165 220 2.9e-16 PFAM
Pfam:PNK3P 211 291 5.3e-27 PFAM
low complexity region 314 328 N/A INTRINSIC
Pfam:AAA_33 330 452 5.6e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107876
AA Change: F169L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103508
Gene: ENSMUSG00000002963
AA Change: F169L

DomainStartEndE-ValueType
PDB:1YJM|C 1 110 4e-62 PDB
SCOP:d1lgpa_ 8 114 5e-12 SMART
Blast:FHA 31 74 1e-10 BLAST
low complexity region 116 134 N/A INTRINSIC
Pfam:PNK3P 165 327 1.9e-57 PFAM
low complexity region 350 364 N/A INTRINSIC
Pfam:AAA_33 366 488 5.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107880
SMART Domains Protein: ENSMUSP00000103512
Gene: ENSMUSG00000011096

DomainStartEndE-ValueType
low complexity region 33 60 N/A INTRINSIC
low complexity region 66 101 N/A INTRINSIC
low complexity region 102 116 N/A INTRINSIC
low complexity region 161 180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107882
SMART Domains Protein: ENSMUSP00000103514
Gene: ENSMUSG00000011096

DomainStartEndE-ValueType
low complexity region 59 86 N/A INTRINSIC
low complexity region 92 127 N/A INTRINSIC
low complexity region 128 142 N/A INTRINSIC
low complexity region 187 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107885
SMART Domains Protein: ENSMUSP00000103517
Gene: ENSMUSG00000011096

DomainStartEndE-ValueType
low complexity region 104 131 N/A INTRINSIC
low complexity region 137 172 N/A INTRINSIC
low complexity region 173 187 N/A INTRINSIC
Pfam:PRAS 199 323 1.2e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123015
SMART Domains Protein: ENSMUSP00000143862
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
PDB:1YJ5|C 1 143 8e-72 PDB
SCOP:d1lgpa_ 8 114 7e-13 SMART
Blast:FHA 31 74 2e-10 BLAST
PDB:3U7G|A 144 165 7e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000124168
SMART Domains Protein: ENSMUSP00000144330
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
PDB:1YJM|C 1 51 3e-30 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000139003
SMART Domains Protein: ENSMUSP00000143904
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
PDB:1YJM|C 1 51 3e-30 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000154968
Predicted Effect probably benign
Transcript: ENSMUST00000155050
SMART Domains Protein: ENSMUSP00000144663
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
PDB:1YJM|C 1 50 9e-30 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000200892
SMART Domains Protein: ENSMUSP00000144163
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
Pfam:AAA_33 18 100 3.9e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201882
AA Change: F169L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144690
Gene: ENSMUSG00000002963
AA Change: F169L

DomainStartEndE-ValueType
PDB:1YJM|C 1 110 6e-63 PDB
SCOP:d1lgpa_ 8 114 3e-12 SMART
Blast:FHA 31 74 2e-10 BLAST
low complexity region 116 134 N/A INTRINSIC
Pfam:PNK3P 165 327 9.9e-55 PFAM
low complexity region 350 364 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202646
SMART Domains Protein: ENSMUSP00000144484
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
Pfam:AAA_33 5 44 6.1e-7 PFAM
Pfam:AAA_33 37 117 4.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207363
Predicted Effect probably benign
Transcript: ENSMUST00000207416
Predicted Effect probably benign
Transcript: ENSMUST00000208385
Predicted Effect probably benign
Transcript: ENSMUST00000208410
Predicted Effect probably benign
Transcript: ENSMUST00000208666
Predicted Effect probably benign
Transcript: ENSMUST00000208682
Predicted Effect probably benign
Transcript: ENSMUST00000209018
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus represents a gene involved in DNA repair. In response to ionizing radiation or oxidative damage, the protein encoded by this locus catalyzes 5' phosphorylation and 3' dephosphorylation of nucleic acids. Mutations at this locus have been associated with microcephaly, seizures, and developmental delay.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes for a frame-shift allele are embryonic lethal. Homozygotes for a hypomorphic allele exhibit smaller brain (cortex and cerebellum) and defects in both single- and double-strand DNA break repair associated with increased brain apoptosis and decreased proliferation in cortical progenitors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A T 7: 139,978,545 probably null Het
Abcb4 T C 5: 8,934,226 V652A probably benign Het
Acvrl1 G T 15: 101,141,072 V417L probably damaging Het
Add1 A G 5: 34,619,371 R479G probably benign Het
Adgb A T 10: 10,400,574 L350Q possibly damaging Het
Adgrl2 A T 3: 148,846,870 S666T probably benign Het
Akap9 T A 5: 4,045,930 D2268E possibly damaging Het
Amigo3 C A 9: 108,054,066 H229Q probably benign Het
Ano6 G C 15: 95,864,244 Q31H possibly damaging Het
Ap4m1 G A 5: 138,175,019 D180N probably damaging Het
Apc2 A T 10: 80,311,740 D876V probably damaging Het
Apcdd1 T A 18: 62,952,188 Y485* probably null Het
Aqp1 G T 6: 55,336,851 D121Y probably benign Het
Bicd2 C A 13: 49,369,609 R141S probably benign Het
Brpf3 C A 17: 28,806,293 H113Q probably benign Het
Cacng2 A T 15: 78,013,320 Y96* probably null Het
Catsperg1 G T 7: 29,210,759 N52K possibly damaging Het
Celsr2 A C 3: 108,394,995 F2606V possibly damaging Het
Cerkl A T 2: 79,332,605 N516K probably benign Het
Ciita G A 16: 10,512,288 R812H probably damaging Het
Cldn3 T A 5: 134,986,983 L180Q probably damaging Het
Cnot6l T C 5: 96,077,299 I512V probably benign Het
Col5a2 A T 1: 45,442,867 D32E unknown Het
Coro7 A G 16: 4,632,048 V616A probably damaging Het
Cyp4f18 T C 8: 71,988,654 D494G probably benign Het
Ddx39 T A 8: 83,722,471 V296E probably benign Het
Dgkg A T 16: 22,548,690 H593Q probably damaging Het
Dhx16 T C 17: 35,886,160 L645P probably damaging Het
Dnah14 A G 1: 181,598,403 M171V probably benign Het
Dnhd1 G A 7: 105,720,930 V4521I probably damaging Het
Dok7 A T 5: 35,064,522 M60L probably benign Het
Donson A T 16: 91,688,711 M1K probably null Het
Dsp C T 13: 38,192,883 T1548M probably benign Het
Dyrk1a A G 16: 94,692,043 T712A probably damaging Het
Eef2 A G 10: 81,181,282 T708A probably benign Het
Epn3 G A 11: 94,493,780 T289I probably benign Het
Fam171a1 C T 2: 3,226,472 R881* probably null Het
Fam71a G A 1: 191,164,353 T31M probably benign Het
Fat2 T A 11: 55,282,304 R2528W probably damaging Het
Fgfr1 T G 8: 25,573,839 F707C probably damaging Het
Frem2 G C 3: 53,654,753 P778A probably damaging Het
Ganc A G 2: 120,430,599 Y255C probably damaging Het
Ginm1 A T 10: 7,777,850 Y65* probably null Het
Gm11559 T A 11: 99,864,881 C119S unknown Het
Gnai1 T A 5: 18,289,551 H188L Het
H6pd C T 4: 149,996,350 A13T probably benign Het
Hist1h2be T C 13: 23,585,923 K12E probably benign Het
Hoxd12 A T 2: 74,675,246 T54S possibly damaging Het
Hs3st5 T A 10: 36,833,194 L242M probably damaging Het
Il9r C A 11: 32,194,389 V139L possibly damaging Het
Immt A G 6: 71,846,369 D68G probably damaging Het
Itsn2 A G 12: 4,632,985 I304V unknown Het
Lgr4 G A 2: 109,996,629 W159* probably null Het
Lin52 G A 12: 84,457,954 G38S probably damaging Het
Lpgat1 A T 1: 191,719,453 M64L probably benign Het
Lrrc10b G T 19: 10,456,778 R180S possibly damaging Het
Lrrc29 T C 8: 105,312,898 D127G probably damaging Het
Lrrc36 A T 8: 105,449,769 L258F possibly damaging Het
Ltbp4 T A 7: 27,329,755 Q235L unknown Het
Maml2 A G 9: 13,621,607 M706V Het
Mc5r G T 18: 68,339,668 C366F probably damaging Het
Mlip T C 9: 77,164,842 R244G probably benign Het
Muc16 T A 9: 18,585,013 R6658S probably benign Het
Mup4 G T 4: 59,960,046 H73N possibly damaging Het
Nf1 A G 11: 79,564,943 M565V probably benign Het
Nphp1 G A 2: 127,761,217 T382I possibly damaging Het
Nrcam C T 12: 44,564,026 T503I possibly damaging Het
Nwd2 A T 5: 63,800,409 N361Y probably damaging Het
Olfr1045 A G 2: 86,198,573 Y60H probably damaging Het
Olfr1309 A T 2: 111,983,327 L249* probably null Het
Olfr308 A G 7: 86,321,574 I126T probably damaging Het
Olfr461 G T 6: 40,544,895 A28E probably damaging Het
Olfr518 A T 7: 108,880,816 H263Q probably damaging Het
Olfr836 A G 9: 19,121,669 Y235C probably benign Het
Olfr993 A T 2: 85,414,444 V145E probably damaging Het
Orc5 A G 5: 22,523,584 F308L probably benign Het
Padi1 T A 4: 140,832,404 Y54F probably benign Het
Parp1 A G 1: 180,569,100 K23E possibly damaging Het
Pate1 A T 9: 35,685,972 V79D possibly damaging Het
Pcdh18 T C 3: 49,756,860 H2R probably benign Het
Pcnx2 G A 8: 125,887,083 S543F probably damaging Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Ppp6r3 A T 19: 3,507,325 N254K probably damaging Het
Psd A G 19: 46,324,454 L159P probably benign Het
Ptprf A G 4: 118,231,669 Y646H probably damaging Het
Rab3ip A T 10: 116,937,633 S92T probably benign Het
Rabgef1 A G 5: 130,187,351 probably benign Het
Ralgapa1 C A 12: 55,709,004 W1129L probably damaging Het
Rhpn2 T A 7: 35,385,463 L594Q probably benign Het
Rnf38 C A 4: 44,158,989 probably benign Het
Ryr2 T A 13: 11,738,194 H1747L possibly damaging Het
Sec16a A G 2: 26,439,717 L13P unknown Het
Sppl3 C A 5: 115,082,335 T102K probably damaging Het
Srgap2 A T 1: 131,291,613 Y264* probably null Het
Stxbp2 T C 8: 3,641,151 M465T Het
Sumf2 A G 5: 129,862,710 K305R probably benign Het
Susd2 T A 10: 75,642,565 Y59F probably benign Het
Taco1 T C 11: 106,072,617 V198A probably benign Het
Tas2r136 A T 6: 132,777,906 M86K possibly damaging Het
Tbc1d10c T C 19: 4,184,898 E388G possibly damaging Het
Tmem132c C T 5: 127,564,059 T1098I possibly damaging Het
Trim3 G T 7: 105,617,800 Y457* probably null Het
Ttc38 A G 15: 85,852,861 T316A probably benign Het
Ubqln4 T A 3: 88,555,910 N127K probably benign Het
Wdr91 A T 6: 34,904,626 F262Y probably damaging Het
Zdhhc6 A T 19: 55,302,755 C343S possibly damaging Het
Zfp248 A G 6: 118,430,209 C140R probably damaging Het
Zfp266 T C 9: 20,502,095 T90A probably benign Het
Zfp407 A T 18: 84,559,042 D1315E possibly damaging Het
Zfp644 T C 5: 106,638,277 S135G probably benign Het
Zscan29 A T 2: 121,160,988 I773N probably damaging Het
Zswim5 T A 4: 116,980,834 V787E possibly damaging Het
Other mutations in Pnkp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01886:Pnkp APN 7 44862207 missense probably damaging 1.00
IGL02750:Pnkp APN 7 44860187 unclassified probably benign
IGL02822:Pnkp APN 7 44862424 missense probably damaging 1.00
R1168:Pnkp UTSW 7 44862537 missense probably benign 0.00
R1437:Pnkp UTSW 7 44860402 missense possibly damaging 0.87
R1953:Pnkp UTSW 7 44862602 missense probably benign 0.02
R2879:Pnkp UTSW 7 44858678 missense probably damaging 0.99
R4329:Pnkp UTSW 7 44858594 missense probably benign 0.02
R4732:Pnkp UTSW 7 44860454 unclassified probably benign
R4842:Pnkp UTSW 7 44861646 splice site probably null
R4846:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R4861:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R4861:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R4872:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R4873:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R4875:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R5068:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R5120:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R5121:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R5266:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R5267:Pnkp UTSW 7 44862403 missense probably damaging 0.99
R6532:Pnkp UTSW 7 44857405 start codon destroyed probably null 0.99
R6974:Pnkp UTSW 7 44861038 missense probably damaging 1.00
R7289:Pnkp UTSW 7 44858690 missense probably damaging 1.00
R7394:Pnkp UTSW 7 44858678 missense probably damaging 0.99
R7573:Pnkp UTSW 7 44857428 missense probably damaging 1.00
R7995:Pnkp UTSW 7 44858536 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGGTATTTAAAGGCTGGTGTCTCC -3'
(R):5'- AGCTTCTTTGGAATCTCTGGGTAC -3'

Sequencing Primer
(F):5'- TTCAGTCCCTATACCTGGGAGG -3'
(R):5'- TGGGTACAGAATCCTAAGGTGGAC -3'
Posted On2019-09-13