Incidental Mutation 'R7326:Trim3'
ID568907
Institutional Source Beutler Lab
Gene Symbol Trim3
Ensembl Gene ENSMUSG00000036989
Gene Nametripartite motif-containing 3
SynonymsHAC1, Rnf22, BERP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7326 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location105604463-105633571 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 105617800 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 457 (Y457*)
Ref Sequence ENSEMBL: ENSMUSP00000053384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057525] [ENSMUST00000106789] [ENSMUST00000106791] [ENSMUST00000147044] [ENSMUST00000153371]
Predicted Effect probably null
Transcript: ENSMUST00000057525
AA Change: Y457*
SMART Domains Protein: ENSMUSP00000053384
Gene: ENSMUSG00000036989
AA Change: Y457*

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 2.5e-9 PFAM
Pfam:NHL 533 560 1.9e-9 PFAM
Pfam:NHL 575 602 5.5e-8 PFAM
Pfam:NHL 622 649 1e-10 PFAM
Pfam:NHL 669 696 1.8e-12 PFAM
Pfam:NHL 713 740 1.9e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106789
AA Change: Y457*
SMART Domains Protein: ENSMUSP00000102401
Gene: ENSMUSG00000036989
AA Change: Y457*

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 1.8e-8 PFAM
Pfam:NHL 533 560 3.9e-10 PFAM
Pfam:NHL 575 602 2.3e-7 PFAM
Pfam:NHL 622 649 3.9e-10 PFAM
Pfam:NHL 669 696 2.2e-12 PFAM
Pfam:NHL 713 740 6.5e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106791
AA Change: Y457*
SMART Domains Protein: ENSMUSP00000102403
Gene: ENSMUSG00000036989
AA Change: Y457*

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 3.4e-8 PFAM
Pfam:NHL 533 560 7.6e-10 PFAM
Pfam:NHL 575 602 4.4e-7 PFAM
Pfam:NHL 622 649 7.6e-10 PFAM
Pfam:NHL 669 696 2.7e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000147044
AA Change: Y457*
SMART Domains Protein: ENSMUSP00000114822
Gene: ENSMUSG00000036989
AA Change: Y457*

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153371
SMART Domains Protein: ENSMUSP00000119910
Gene: ENSMUSG00000036989

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 157 3.55e-10 SMART
Blast:BBC 164 199 9e-15 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family, also called the 'RING-B-box-coiled-coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to cytoplasmic filaments. It is similar to a rat protein which is a specific partner for the tail domain of myosin V, a class of myosins which are involved in the targeted transport of organelles. The rat protein can also interact with alpha-actinin-4. Thus it is suggested that this human protein may play a role in myosin V-mediated cargo transport. Alternatively spliced transcript variants encoding the same isoform have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have decreased susceptibility to pharmacologically induced seizure as well as reduced miniature inhibitory synaptic current amplitude in cortical neurons. Mice homozygous for another null allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A T 7: 139,978,545 probably null Het
Abcb4 T C 5: 8,934,226 V652A probably benign Het
Acvrl1 G T 15: 101,141,072 V417L probably damaging Het
Add1 A G 5: 34,619,371 R479G probably benign Het
Adgb A T 10: 10,400,574 L350Q possibly damaging Het
Adgrl2 A T 3: 148,846,870 S666T probably benign Het
Akap9 T A 5: 4,045,930 D2268E possibly damaging Het
Amigo3 C A 9: 108,054,066 H229Q probably benign Het
Ano6 G C 15: 95,864,244 Q31H possibly damaging Het
Ap4m1 G A 5: 138,175,019 D180N probably damaging Het
Apc2 A T 10: 80,311,740 D876V probably damaging Het
Apcdd1 T A 18: 62,952,188 Y485* probably null Het
Aqp1 G T 6: 55,336,851 D121Y probably benign Het
Bicd2 C A 13: 49,369,609 R141S probably benign Het
Brpf3 C A 17: 28,806,293 H113Q probably benign Het
Cacng2 A T 15: 78,013,320 Y96* probably null Het
Catsperg1 G T 7: 29,210,759 N52K possibly damaging Het
Celsr2 A C 3: 108,394,995 F2606V possibly damaging Het
Cerkl A T 2: 79,332,605 N516K probably benign Het
Ciita G A 16: 10,512,288 R812H probably damaging Het
Cldn3 T A 5: 134,986,983 L180Q probably damaging Het
Cnot6l T C 5: 96,077,299 I512V probably benign Het
Col5a2 A T 1: 45,442,867 D32E unknown Het
Coro7 A G 16: 4,632,048 V616A probably damaging Het
Cyp4f18 T C 8: 71,988,654 D494G probably benign Het
Ddx39 T A 8: 83,722,471 V296E probably benign Het
Dgkg A T 16: 22,548,690 H593Q probably damaging Het
Dhx16 T C 17: 35,886,160 L645P probably damaging Het
Dnah14 A G 1: 181,598,403 M171V probably benign Het
Dnhd1 G A 7: 105,720,930 V4521I probably damaging Het
Dok7 A T 5: 35,064,522 M60L probably benign Het
Donson A T 16: 91,688,711 M1K probably null Het
Dsp C T 13: 38,192,883 T1548M probably benign Het
Dyrk1a A G 16: 94,692,043 T712A probably damaging Het
Eef2 A G 10: 81,181,282 T708A probably benign Het
Epn3 G A 11: 94,493,780 T289I probably benign Het
Fam171a1 C T 2: 3,226,472 R881* probably null Het
Fam71a G A 1: 191,164,353 T31M probably benign Het
Fat2 T A 11: 55,282,304 R2528W probably damaging Het
Fgfr1 T G 8: 25,573,839 F707C probably damaging Het
Frem2 G C 3: 53,654,753 P778A probably damaging Het
Ganc A G 2: 120,430,599 Y255C probably damaging Het
Ginm1 A T 10: 7,777,850 Y65* probably null Het
Gm11559 T A 11: 99,864,881 C119S unknown Het
Gnai1 T A 5: 18,289,551 H188L Het
H6pd C T 4: 149,996,350 A13T probably benign Het
Hist1h2be T C 13: 23,585,923 K12E probably benign Het
Hoxd12 A T 2: 74,675,246 T54S possibly damaging Het
Hs3st5 T A 10: 36,833,194 L242M probably damaging Het
Il9r C A 11: 32,194,389 V139L possibly damaging Het
Immt A G 6: 71,846,369 D68G probably damaging Het
Itsn2 A G 12: 4,632,985 I304V unknown Het
Lgr4 G A 2: 109,996,629 W159* probably null Het
Lin52 G A 12: 84,457,954 G38S probably damaging Het
Lpgat1 A T 1: 191,719,453 M64L probably benign Het
Lrrc10b G T 19: 10,456,778 R180S possibly damaging Het
Lrrc29 T C 8: 105,312,898 D127G probably damaging Het
Lrrc36 A T 8: 105,449,769 L258F possibly damaging Het
Ltbp4 T A 7: 27,329,755 Q235L unknown Het
Maml2 A G 9: 13,621,607 M706V Het
Mc5r G T 18: 68,339,668 C366F probably damaging Het
Mlip T C 9: 77,164,842 R244G probably benign Het
Muc16 T A 9: 18,585,013 R6658S probably benign Het
Mup4 G T 4: 59,960,046 H73N possibly damaging Het
Nf1 A G 11: 79,564,943 M565V probably benign Het
Nphp1 G A 2: 127,761,217 T382I possibly damaging Het
Nrcam C T 12: 44,564,026 T503I possibly damaging Het
Nwd2 A T 5: 63,800,409 N361Y probably damaging Het
Olfr1045 A G 2: 86,198,573 Y60H probably damaging Het
Olfr1309 A T 2: 111,983,327 L249* probably null Het
Olfr308 A G 7: 86,321,574 I126T probably damaging Het
Olfr461 G T 6: 40,544,895 A28E probably damaging Het
Olfr518 A T 7: 108,880,816 H263Q probably damaging Het
Olfr836 A G 9: 19,121,669 Y235C probably benign Het
Olfr993 A T 2: 85,414,444 V145E probably damaging Het
Orc5 A G 5: 22,523,584 F308L probably benign Het
Padi1 T A 4: 140,832,404 Y54F probably benign Het
Parp1 A G 1: 180,569,100 K23E possibly damaging Het
Pate1 A T 9: 35,685,972 V79D possibly damaging Het
Pcdh18 T C 3: 49,756,860 H2R probably benign Het
Pcnx2 G A 8: 125,887,083 S543F probably damaging Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pnkp T A 7: 44,859,734 F169L probably damaging Het
Ppp6r3 A T 19: 3,507,325 N254K probably damaging Het
Psd A G 19: 46,324,454 L159P probably benign Het
Ptprf A G 4: 118,231,669 Y646H probably damaging Het
Rab3ip A T 10: 116,937,633 S92T probably benign Het
Rabgef1 A G 5: 130,187,351 probably benign Het
Ralgapa1 C A 12: 55,709,004 W1129L probably damaging Het
Rhpn2 T A 7: 35,385,463 L594Q probably benign Het
Rnf38 C A 4: 44,158,989 probably benign Het
Ryr2 T A 13: 11,738,194 H1747L possibly damaging Het
Sec16a A G 2: 26,439,717 L13P unknown Het
Sppl3 C A 5: 115,082,335 T102K probably damaging Het
Srgap2 A T 1: 131,291,613 Y264* probably null Het
Stxbp2 T C 8: 3,641,151 M465T Het
Sumf2 A G 5: 129,862,710 K305R probably benign Het
Susd2 T A 10: 75,642,565 Y59F probably benign Het
Taco1 T C 11: 106,072,617 V198A probably benign Het
Tas2r136 A T 6: 132,777,906 M86K possibly damaging Het
Tbc1d10c T C 19: 4,184,898 E388G possibly damaging Het
Tmem132c C T 5: 127,564,059 T1098I possibly damaging Het
Ttc38 A G 15: 85,852,861 T316A probably benign Het
Ubqln4 T A 3: 88,555,910 N127K probably benign Het
Wdr91 A T 6: 34,904,626 F262Y probably damaging Het
Zdhhc6 A T 19: 55,302,755 C343S possibly damaging Het
Zfp248 A G 6: 118,430,209 C140R probably damaging Het
Zfp266 T C 9: 20,502,095 T90A probably benign Het
Zfp407 A T 18: 84,559,042 D1315E possibly damaging Het
Zfp644 T C 5: 106,638,277 S135G probably benign Het
Zscan29 A T 2: 121,160,988 I773N probably damaging Het
Zswim5 T A 4: 116,980,834 V787E possibly damaging Het
Other mutations in Trim3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Trim3 APN 7 105617469 missense probably damaging 1.00
IGL01543:Trim3 APN 7 105613313 missense probably damaging 1.00
IGL01573:Trim3 APN 7 105625493 missense possibly damaging 0.62
IGL01995:Trim3 APN 7 105618482 splice site probably benign
IGL02407:Trim3 APN 7 105613011 missense probably benign 0.44
IGL02868:Trim3 APN 7 105613032 missense possibly damaging 0.82
IGL02837:Trim3 UTSW 7 105612656 missense probably damaging 1.00
PIT4514001:Trim3 UTSW 7 105618210 missense probably benign 0.08
R1013:Trim3 UTSW 7 105617895 missense probably benign 0.10
R2296:Trim3 UTSW 7 105613274 missense probably damaging 1.00
R3724:Trim3 UTSW 7 105611189 missense probably damaging 1.00
R4028:Trim3 UTSW 7 105618245 missense probably benign 0.04
R4347:Trim3 UTSW 7 105619387 missense probably damaging 1.00
R4383:Trim3 UTSW 7 105618399 missense probably damaging 1.00
R4475:Trim3 UTSW 7 105617802 missense probably damaging 1.00
R4567:Trim3 UTSW 7 105613416 missense possibly damaging 0.88
R4886:Trim3 UTSW 7 105617840 missense probably damaging 1.00
R4981:Trim3 UTSW 7 105619128 missense probably damaging 0.99
R5053:Trim3 UTSW 7 105617761 missense probably damaging 1.00
R5190:Trim3 UTSW 7 105619509 missense probably damaging 1.00
R5230:Trim3 UTSW 7 105619513 missense possibly damaging 0.81
R5364:Trim3 UTSW 7 105619069 missense probably damaging 0.96
R5382:Trim3 UTSW 7 105618347 missense probably benign 0.10
R5712:Trim3 UTSW 7 105619536 missense probably damaging 0.99
R5725:Trim3 UTSW 7 105617740 critical splice donor site probably null
R5915:Trim3 UTSW 7 105617975 missense possibly damaging 0.82
R6058:Trim3 UTSW 7 105611071 missense probably damaging 0.98
R6073:Trim3 UTSW 7 105617539 missense probably damaging 1.00
R6430:Trim3 UTSW 7 105618005 missense probably benign 0.20
R6589:Trim3 UTSW 7 105617960 missense probably damaging 1.00
R7044:Trim3 UTSW 7 105618214 missense probably damaging 0.97
R7207:Trim3 UTSW 7 105613376 missense possibly damaging 0.87
R7454:Trim3 UTSW 7 105619558 missense probably damaging 1.00
R7459:Trim3 UTSW 7 105617808 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTAGTTTGAGCCTCGCTTC -3'
(R):5'- TACACTGCACGCACAGAAGG -3'

Sequencing Primer
(F):5'- TCCCCAAACCCCTGTCTGAG -3'
(R):5'- AGAAGGTGACCTGCTCCTCTC -3'
Posted On2019-09-13