Incidental Mutation 'R7326:Zfp407'
ID 568959
Institutional Source Beutler Lab
Gene Symbol Zfp407
Ensembl Gene ENSMUSG00000048410
Gene Name zinc finger protein 407
Synonyms 6430585N13Rik, LOC240469, LOC381139
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7326 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 84128027-84589725 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 84559042 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1315 (D1315E)
Ref Sequence ENSEMBL: ENSMUSP00000118361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000125763]
AlphaFold G3UVV3
Predicted Effect probably benign
Transcript: ENSMUST00000125450
Predicted Effect possibly damaging
Transcript: ENSMUST00000125763
AA Change: D1315E

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118361
Gene: ENSMUSG00000048410
AA Change: D1315E

DomainStartEndE-ValueType
low complexity region 20 37 N/A INTRINSIC
ZnF_C2H2 178 200 8.67e-1 SMART
ZnF_U1 233 267 6.79e-1 SMART
ZnF_C2H2 236 260 4.65e-1 SMART
ZnF_C2H2 522 545 7.05e-1 SMART
ZnF_U1 548 582 1.54e1 SMART
ZnF_C2H2 551 575 1.01e-1 SMART
ZnF_C2H2 582 605 1.41e0 SMART
ZnF_U1 606 639 2.22e0 SMART
ZnF_C2H2 609 632 1.01e2 SMART
ZnF_C2H2 695 718 6.23e-2 SMART
ZnF_U1 721 755 2.96e0 SMART
ZnF_C2H2 724 748 7.11e0 SMART
ZnF_C2H2 840 863 7.55e-1 SMART
ZnF_U1 866 900 3.81e-1 SMART
ZnF_C2H2 869 893 1.07e0 SMART
ZnF_C2H2 1009 1032 6.13e-1 SMART
ZnF_U1 1035 1069 2.22e0 SMART
ZnF_C2H2 1038 1062 5.62e0 SMART
low complexity region 1223 1234 N/A INTRINSIC
ZnF_C2H2 1405 1428 5.92e0 SMART
ZnF_U1 1432 1466 2.35e0 SMART
ZnF_C2H2 1435 1459 1.76e-1 SMART
ZnF_C2H2 1477 1500 5.42e-2 SMART
ZnF_C2H2 1528 1552 1.68e1 SMART
ZnF_C2H2 1558 1580 1.43e-1 SMART
ZnF_C2H2 1586 1609 9.58e-3 SMART
ZnF_C2H2 1619 1641 2.61e-4 SMART
ZnF_C2H2 1647 1671 1.04e-3 SMART
ZnF_C2H2 1677 1699 9.44e-2 SMART
ZnF_C2H2 1705 1727 1.82e-3 SMART
ZnF_C2H2 1733 1758 4.65e-1 SMART
ZnF_C2H2 1764 1787 1.26e-2 SMART
low complexity region 1876 1887 N/A INTRINSIC
low complexity region 2017 2032 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein whose exact function is not known. It may be involved in transcriptional regulation. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A T 7: 139,978,545 probably null Het
Abcb4 T C 5: 8,934,226 V652A probably benign Het
Acvrl1 G T 15: 101,141,072 V417L probably damaging Het
Add1 A G 5: 34,619,371 R479G probably benign Het
Adgb A T 10: 10,400,574 L350Q possibly damaging Het
Adgrl2 A T 3: 148,846,870 S666T probably benign Het
Akap9 T A 5: 4,045,930 D2268E possibly damaging Het
Amigo3 C A 9: 108,054,066 H229Q probably benign Het
Ano6 G C 15: 95,864,244 Q31H possibly damaging Het
Ap4m1 G A 5: 138,175,019 D180N probably damaging Het
Apc2 A T 10: 80,311,740 D876V probably damaging Het
Apcdd1 T A 18: 62,952,188 Y485* probably null Het
Aqp1 G T 6: 55,336,851 D121Y probably benign Het
Bicd2 C A 13: 49,369,609 R141S probably benign Het
Brpf3 C A 17: 28,806,293 H113Q probably benign Het
Cacng2 A T 15: 78,013,320 Y96* probably null Het
Catsperg1 G T 7: 29,210,759 N52K possibly damaging Het
Celsr2 A C 3: 108,394,995 F2606V possibly damaging Het
Cerkl A T 2: 79,332,605 N516K probably benign Het
Ciita G A 16: 10,512,288 R812H probably damaging Het
Cldn3 T A 5: 134,986,983 L180Q probably damaging Het
Cnot6l T C 5: 96,077,299 I512V probably benign Het
Col5a2 A T 1: 45,442,867 D32E unknown Het
Coro7 A G 16: 4,632,048 V616A probably damaging Het
Cyp4f18 T C 8: 71,988,654 D494G probably benign Het
Ddx39 T A 8: 83,722,471 V296E probably benign Het
Dgkg A T 16: 22,548,690 H593Q probably damaging Het
Dhx16 T C 17: 35,886,160 L645P probably damaging Het
Dnah14 A G 1: 181,598,403 M171V probably benign Het
Dnhd1 G A 7: 105,720,930 V4521I probably damaging Het
Dok7 A T 5: 35,064,522 M60L probably benign Het
Donson A T 16: 91,688,711 M1K probably null Het
Dsp C T 13: 38,192,883 T1548M probably benign Het
Dyrk1a A G 16: 94,692,043 T712A probably damaging Het
Eef2 A G 10: 81,181,282 T708A probably benign Het
Epn3 G A 11: 94,493,780 T289I probably benign Het
Fam171a1 C T 2: 3,226,472 R881* probably null Het
Fam71a G A 1: 191,164,353 T31M probably benign Het
Fat2 T A 11: 55,282,304 R2528W probably damaging Het
Fgfr1 T G 8: 25,573,839 F707C probably damaging Het
Frem2 G C 3: 53,654,753 P778A probably damaging Het
Ganc A G 2: 120,430,599 Y255C probably damaging Het
Ginm1 A T 10: 7,777,850 Y65* probably null Het
Gm11559 T A 11: 99,864,881 C119S unknown Het
Gnai1 T A 5: 18,289,551 H188L Het
H6pd C T 4: 149,996,350 A13T probably benign Het
Hist1h2be T C 13: 23,585,923 K12E probably benign Het
Hoxd12 A T 2: 74,675,246 T54S possibly damaging Het
Hs3st5 T A 10: 36,833,194 L242M probably damaging Het
Il9r C A 11: 32,194,389 V139L possibly damaging Het
Immt A G 6: 71,846,369 D68G probably damaging Het
Itsn2 A G 12: 4,632,985 I304V unknown Het
Lgr4 G A 2: 109,996,629 W159* probably null Het
Lin52 G A 12: 84,457,954 G38S probably damaging Het
Lpgat1 A T 1: 191,719,453 M64L probably benign Het
Lrrc10b G T 19: 10,456,778 R180S possibly damaging Het
Lrrc29 T C 8: 105,312,898 D127G probably damaging Het
Lrrc36 A T 8: 105,449,769 L258F possibly damaging Het
Ltbp4 T A 7: 27,329,755 Q235L unknown Het
Maml2 A G 9: 13,621,607 M706V Het
Mc5r G T 18: 68,339,668 C366F probably damaging Het
Mlip T C 9: 77,164,842 R244G probably benign Het
Muc16 T A 9: 18,585,013 R6658S probably benign Het
Mup4 G T 4: 59,960,046 H73N possibly damaging Het
Nf1 A G 11: 79,564,943 M565V probably benign Het
Nphp1 G A 2: 127,761,217 T382I possibly damaging Het
Nrcam C T 12: 44,564,026 T503I possibly damaging Het
Nwd2 A T 5: 63,800,409 N361Y probably damaging Het
Olfr1045 A G 2: 86,198,573 Y60H probably damaging Het
Olfr1309 A T 2: 111,983,327 L249* probably null Het
Olfr308 A G 7: 86,321,574 I126T probably damaging Het
Olfr461 G T 6: 40,544,895 A28E probably damaging Het
Olfr518 A T 7: 108,880,816 H263Q probably damaging Het
Olfr836 A G 9: 19,121,669 Y235C probably benign Het
Olfr993 A T 2: 85,414,444 V145E probably damaging Het
Orc5 A G 5: 22,523,584 F308L probably benign Het
Padi1 T A 4: 140,832,404 Y54F probably benign Het
Parp1 A G 1: 180,569,100 K23E possibly damaging Het
Pate1 A T 9: 35,685,972 V79D possibly damaging Het
Pcdh18 T C 3: 49,756,860 H2R probably benign Het
Pcnx2 G A 8: 125,887,083 S543F probably damaging Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pnkp T A 7: 44,859,734 F169L probably damaging Het
Ppp6r3 A T 19: 3,507,325 N254K probably damaging Het
Psd A G 19: 46,324,454 L159P probably benign Het
Ptprf A G 4: 118,231,669 Y646H probably damaging Het
Rab3ip A T 10: 116,937,633 S92T probably benign Het
Rabgef1 A G 5: 130,187,351 probably benign Het
Ralgapa1 C A 12: 55,709,004 W1129L probably damaging Het
Rhpn2 T A 7: 35,385,463 L594Q probably benign Het
Rnf38 C A 4: 44,158,989 probably benign Het
Ryr2 T A 13: 11,738,194 H1747L possibly damaging Het
Sec16a A G 2: 26,439,717 L13P unknown Het
Sppl3 C A 5: 115,082,335 T102K probably damaging Het
Srgap2 A T 1: 131,291,613 Y264* probably null Het
Stxbp2 T C 8: 3,641,151 M465T Het
Sumf2 A G 5: 129,862,710 K305R probably benign Het
Susd2 T A 10: 75,642,565 Y59F probably benign Het
Taco1 T C 11: 106,072,617 V198A probably benign Het
Tas2r136 A T 6: 132,777,906 M86K possibly damaging Het
Tbc1d10c T C 19: 4,184,898 E388G possibly damaging Het
Tmem132c C T 5: 127,564,059 T1098I possibly damaging Het
Trim3 G T 7: 105,617,800 Y457* probably null Het
Ttc38 A G 15: 85,852,861 T316A probably benign Het
Ubqln4 T A 3: 88,555,910 N127K probably benign Het
Wdr91 A T 6: 34,904,626 F262Y probably damaging Het
Zdhhc6 A T 19: 55,302,755 C343S possibly damaging Het
Zfp248 A G 6: 118,430,209 C140R probably damaging Het
Zfp266 T C 9: 20,502,095 T90A probably benign Het
Zfp644 T C 5: 106,638,277 S135G probably benign Het
Zscan29 A T 2: 121,160,988 I773N probably damaging Het
Zswim5 T A 4: 116,980,834 V787E possibly damaging Het
Other mutations in Zfp407
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Zfp407 APN 18 84561752 missense probably damaging 0.99
IGL02105:Zfp407 APN 18 84562720 nonsense probably null
IGL02110:Zfp407 APN 18 84559040 missense probably benign 0.00
IGL02343:Zfp407 APN 18 84209724 missense possibly damaging 0.71
IGL02456:Zfp407 APN 18 84558641 missense probably damaging 1.00
IGL02705:Zfp407 APN 18 84559031 nonsense probably null
IGL02946:Zfp407 APN 18 84560709 missense probably damaging 1.00
IGL03069:Zfp407 APN 18 84350975 missense probably damaging 1.00
IGL03145:Zfp407 APN 18 84209721 missense probably damaging 0.99
IGL03403:Zfp407 APN 18 84560797 missense probably damaging 1.00
IGL03134:Zfp407 UTSW 18 84209955 missense probably damaging 0.99
PIT4362001:Zfp407 UTSW 18 84561268 missense possibly damaging 0.87
PIT4520001:Zfp407 UTSW 18 84432420 missense probably damaging 0.99
R0087:Zfp407 UTSW 18 84560411 missense probably damaging 1.00
R0243:Zfp407 UTSW 18 84558711 missense probably damaging 1.00
R0594:Zfp407 UTSW 18 84562567 missense possibly damaging 0.87
R0766:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R0787:Zfp407 UTSW 18 84209022 missense probably damaging 1.00
R0787:Zfp407 UTSW 18 84209346 missense probably benign 0.00
R1065:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1086:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1165:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1186:Zfp407 UTSW 18 84209448 missense probably benign 0.39
R1203:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1312:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1345:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1385:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1421:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1430:Zfp407 UTSW 18 84209455 missense probably benign 0.18
R1436:Zfp407 UTSW 18 84343071 splice site probably benign
R1498:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1526:Zfp407 UTSW 18 84561033 missense possibly damaging 0.61
R1579:Zfp407 UTSW 18 84209638 missense probably benign 0.00
R1594:Zfp407 UTSW 18 84209331 missense probably benign 0.01
R1628:Zfp407 UTSW 18 84354533 missense probably damaging 1.00
R1698:Zfp407 UTSW 18 84562157 missense probably damaging 1.00
R1962:Zfp407 UTSW 18 84559336 missense probably benign 0.01
R1984:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1985:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1986:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R2151:Zfp407 UTSW 18 84209649 missense possibly damaging 0.55
R2152:Zfp407 UTSW 18 84209649 missense possibly damaging 0.55
R2154:Zfp407 UTSW 18 84209649 missense possibly damaging 0.55
R2259:Zfp407 UTSW 18 84209793 missense probably damaging 1.00
R2353:Zfp407 UTSW 18 84559880 missense probably damaging 1.00
R2845:Zfp407 UTSW 18 84558397 nonsense probably null
R3407:Zfp407 UTSW 18 84558872 missense probably benign 0.08
R3432:Zfp407 UTSW 18 84208746 missense probably damaging 1.00
R3892:Zfp407 UTSW 18 84560352 missense probably damaging 1.00
R4026:Zfp407 UTSW 18 84559596 missense possibly damaging 0.82
R4107:Zfp407 UTSW 18 84343007 missense possibly damaging 0.82
R4398:Zfp407 UTSW 18 84562731 nonsense probably null
R4447:Zfp407 UTSW 18 84562694 missense possibly damaging 0.95
R4752:Zfp407 UTSW 18 84562914 missense probably benign 0.01
R4881:Zfp407 UTSW 18 84559703 missense probably benign 0.27
R4936:Zfp407 UTSW 18 84559464 missense probably benign 0.00
R5194:Zfp407 UTSW 18 84561309 missense probably benign 0.05
R5243:Zfp407 UTSW 18 84561091 missense probably damaging 1.00
R5258:Zfp407 UTSW 18 84315926 missense probably damaging 1.00
R5591:Zfp407 UTSW 18 84561137 missense probably damaging 1.00
R5633:Zfp407 UTSW 18 84561044 missense probably benign 0.35
R5739:Zfp407 UTSW 18 84208742 makesense probably null
R5806:Zfp407 UTSW 18 84558614 missense probably damaging 1.00
R5820:Zfp407 UTSW 18 84560524 missense probably benign 0.01
R6187:Zfp407 UTSW 18 84559009 missense possibly damaging 0.87
R6512:Zfp407 UTSW 18 84560349 missense probably damaging 1.00
R6521:Zfp407 UTSW 18 84432411 missense probably damaging 1.00
R6748:Zfp407 UTSW 18 84208830 missense probably damaging 0.98
R6882:Zfp407 UTSW 18 84343069 splice site probably null
R6899:Zfp407 UTSW 18 84561434 missense possibly damaging 0.86
R7038:Zfp407 UTSW 18 84561857 missense probably damaging 1.00
R7076:Zfp407 UTSW 18 84558476 missense probably damaging 1.00
R7397:Zfp407 UTSW 18 84561819 missense possibly damaging 0.59
R7402:Zfp407 UTSW 18 84561536 missense probably benign 0.02
R7783:Zfp407 UTSW 18 84209922 missense possibly damaging 0.69
R7800:Zfp407 UTSW 18 84560675 missense probably damaging 0.99
R7904:Zfp407 UTSW 18 84561256 missense not run
R7942:Zfp407 UTSW 18 84559629 missense probably benign 0.02
R7955:Zfp407 UTSW 18 84559291 missense probably benign 0.02
R7988:Zfp407 UTSW 18 84559400 missense possibly damaging 0.60
R8125:Zfp407 UTSW 18 84561185 missense probably damaging 1.00
R8237:Zfp407 UTSW 18 84560144 missense possibly damaging 0.87
R8364:Zfp407 UTSW 18 84552868 critical splice donor site probably null
R8443:Zfp407 UTSW 18 84209862 missense probably damaging 1.00
R8487:Zfp407 UTSW 18 84562770 nonsense probably null
R8497:Zfp407 UTSW 18 84559896 missense probably damaging 0.98
R8808:Zfp407 UTSW 18 84343060 missense probably benign 0.17
R8848:Zfp407 UTSW 18 84560694 missense probably damaging 1.00
R8913:Zfp407 UTSW 18 84560528 missense probably damaging 0.99
R8962:Zfp407 UTSW 18 84558932 missense probably damaging 1.00
R9087:Zfp407 UTSW 18 84209857 missense probably damaging 0.96
RF003:Zfp407 UTSW 18 84209563 missense probably benign 0.17
Z1177:Zfp407 UTSW 18 84209954 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGGGCAACTCACTAACTCTC -3'
(R):5'- GGCCATTCTGCCGAATCTAC -3'

Sequencing Primer
(F):5'- GGCAACTCACTAACTCTCCCTCC -3'
(R):5'- CGAATCTACTTCCTCTGTGGTAATG -3'
Posted On 2019-09-13