Incidental Mutation 'R7326:Nrcam'
ID568939
Institutional Source Beutler Lab
Gene Symbol Nrcam
Ensembl Gene ENSMUSG00000020598
Gene Nameneuronal cell adhesion molecule
SynonymsC030017F07Rik, Bravo, C130076O07Rik
MMRRC Submission
Accession Numbers

Genbank: NM_176930.4, NM_001146031.1,

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7326 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location44328885-44601964 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44564026 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 503 (T503I)
Ref Sequence ENSEMBL: ENSMUSP00000020939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020939] [ENSMUST00000110748] [ENSMUST00000220123]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020939
AA Change: T503I

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020939
Gene: ENSMUSG00000020598
AA Change: T503I

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IGc2 53 124 5.37e-4 SMART
IG 146 233 3.91e-6 SMART
IGc2 277 341 1.73e-16 SMART
IGc2 367 433 4.85e-11 SMART
IGc2 461 526 4.92e-12 SMART
IGc2 552 617 6.55e-8 SMART
low complexity region 618 623 N/A INTRINSIC
FN3 641 724 3.24e-10 SMART
FN3 738 824 1.77e-2 SMART
FN3 840 931 1.97e-9 SMART
FN3 946 1031 3.73e-10 SMART
transmembrane domain 1120 1142 N/A INTRINSIC
Pfam:Bravo_FIGEY 1143 1232 2.9e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110748
AA Change: T503I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106376
Gene: ENSMUSG00000020598
AA Change: T503I

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IGc2 53 124 5.37e-4 SMART
IG 146 233 3.91e-6 SMART
IGc2 277 341 1.73e-16 SMART
IGc2 367 433 4.85e-11 SMART
IGc2 461 526 4.92e-12 SMART
IGc2 552 617 6.55e-8 SMART
FN3 631 714 3.24e-10 SMART
FN3 728 814 1.77e-2 SMART
FN3 830 921 1.97e-9 SMART
FN3 936 1021 3.73e-10 SMART
transmembrane domain 1050 1072 N/A INTRINSIC
Pfam:Bravo_FIGEY 1073 1164 9.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219906
Predicted Effect probably damaging
Transcript: ENSMUST00000220123
AA Change: T509I

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell adhesion molecules (CAMs) are members of the immunoglobulin superfamily. This gene encodes a neuronal cell adhesion molecule with multiple immunoglobulin-like C2-type domains and fibronectin type-III domains. This ankyrin-binding protein is involved in neuron-neuron adhesion and promotes directional signaling during axonal cone growth. This gene is also expressed in non-neural tissues and may play a general role in cell-cell communication via signaling from its intracellular domain to the actin cytoskeleton during directional cell migration. Allelic variants of this gene have been associated with autism and addiction vulnerability. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit disorganization of lens fibers, cellular disintegration, and accumulation of cellular debris resulting in cataracts. Mutants show mild reductions in cerebellar lobe size. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, knock-out(2) Targeted, other(4) Gene trapped(2) Chemically induced(1)

Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A T 7: 139,978,545 probably null Het
Abcb4 T C 5: 8,934,226 V652A probably benign Het
Acvrl1 G T 15: 101,141,072 V417L probably damaging Het
Add1 A G 5: 34,619,371 R479G probably benign Het
Adgb A T 10: 10,400,574 L350Q possibly damaging Het
Adgrl2 A T 3: 148,846,870 S666T probably benign Het
Akap9 T A 5: 4,045,930 D2268E possibly damaging Het
Amigo3 C A 9: 108,054,066 H229Q probably benign Het
Ano6 G C 15: 95,864,244 Q31H possibly damaging Het
Ap4m1 G A 5: 138,175,019 D180N probably damaging Het
Apc2 A T 10: 80,311,740 D876V probably damaging Het
Apcdd1 T A 18: 62,952,188 Y485* probably null Het
Aqp1 G T 6: 55,336,851 D121Y probably benign Het
Bicd2 C A 13: 49,369,609 R141S probably benign Het
Brpf3 C A 17: 28,806,293 H113Q probably benign Het
Cacng2 A T 15: 78,013,320 Y96* probably null Het
Catsperg1 G T 7: 29,210,759 N52K possibly damaging Het
Celsr2 A C 3: 108,394,995 F2606V possibly damaging Het
Cerkl A T 2: 79,332,605 N516K probably benign Het
Ciita G A 16: 10,512,288 R812H probably damaging Het
Cldn3 T A 5: 134,986,983 L180Q probably damaging Het
Cnot6l T C 5: 96,077,299 I512V probably benign Het
Col5a2 A T 1: 45,442,867 D32E unknown Het
Coro7 A G 16: 4,632,048 V616A probably damaging Het
Cyp4f18 T C 8: 71,988,654 D494G probably benign Het
Ddx39 T A 8: 83,722,471 V296E probably benign Het
Dgkg A T 16: 22,548,690 H593Q probably damaging Het
Dhx16 T C 17: 35,886,160 L645P probably damaging Het
Dnah14 A G 1: 181,598,403 M171V probably benign Het
Dnhd1 G A 7: 105,720,930 V4521I probably damaging Het
Dok7 A T 5: 35,064,522 M60L probably benign Het
Donson A T 16: 91,688,711 M1K probably null Het
Dsp C T 13: 38,192,883 T1548M probably benign Het
Dyrk1a A G 16: 94,692,043 T712A probably damaging Het
Eef2 A G 10: 81,181,282 T708A probably benign Het
Epn3 G A 11: 94,493,780 T289I probably benign Het
Fam171a1 C T 2: 3,226,472 R881* probably null Het
Fam71a G A 1: 191,164,353 T31M probably benign Het
Fat2 T A 11: 55,282,304 R2528W probably damaging Het
Fgfr1 T G 8: 25,573,839 F707C probably damaging Het
Frem2 G C 3: 53,654,753 P778A probably damaging Het
Ganc A G 2: 120,430,599 Y255C probably damaging Het
Ginm1 A T 10: 7,777,850 Y65* probably null Het
Gm11559 T A 11: 99,864,881 C119S unknown Het
Gnai1 T A 5: 18,289,551 H188L Het
H6pd C T 4: 149,996,350 A13T probably benign Het
Hist1h2be T C 13: 23,585,923 K12E probably benign Het
Hoxd12 A T 2: 74,675,246 T54S possibly damaging Het
Hs3st5 T A 10: 36,833,194 L242M probably damaging Het
Il9r C A 11: 32,194,389 V139L possibly damaging Het
Immt A G 6: 71,846,369 D68G probably damaging Het
Itsn2 A G 12: 4,632,985 I304V unknown Het
Lgr4 G A 2: 109,996,629 W159* probably null Het
Lin52 G A 12: 84,457,954 G38S probably damaging Het
Lpgat1 A T 1: 191,719,453 M64L probably benign Het
Lrrc10b G T 19: 10,456,778 R180S possibly damaging Het
Lrrc29 T C 8: 105,312,898 D127G probably damaging Het
Lrrc36 A T 8: 105,449,769 L258F possibly damaging Het
Ltbp4 T A 7: 27,329,755 Q235L unknown Het
Maml2 A G 9: 13,621,607 M706V Het
Mc5r G T 18: 68,339,668 C366F probably damaging Het
Mlip T C 9: 77,164,842 R244G probably benign Het
Muc16 T A 9: 18,585,013 R6658S probably benign Het
Mup4 G T 4: 59,960,046 H73N possibly damaging Het
Nf1 A G 11: 79,564,943 M565V probably benign Het
Nphp1 G A 2: 127,761,217 T382I possibly damaging Het
Nwd2 A T 5: 63,800,409 N361Y probably damaging Het
Olfr1045 A G 2: 86,198,573 Y60H probably damaging Het
Olfr1309 A T 2: 111,983,327 L249* probably null Het
Olfr308 A G 7: 86,321,574 I126T probably damaging Het
Olfr461 G T 6: 40,544,895 A28E probably damaging Het
Olfr518 A T 7: 108,880,816 H263Q probably damaging Het
Olfr836 A G 9: 19,121,669 Y235C probably benign Het
Olfr993 A T 2: 85,414,444 V145E probably damaging Het
Orc5 A G 5: 22,523,584 F308L probably benign Het
Padi1 T A 4: 140,832,404 Y54F probably benign Het
Parp1 A G 1: 180,569,100 K23E possibly damaging Het
Pate1 A T 9: 35,685,972 V79D possibly damaging Het
Pcdh18 T C 3: 49,756,860 H2R probably benign Het
Pcnx2 G A 8: 125,887,083 S543F probably damaging Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pnkp T A 7: 44,859,734 F169L probably damaging Het
Ppp6r3 A T 19: 3,507,325 N254K probably damaging Het
Psd A G 19: 46,324,454 L159P probably benign Het
Ptprf A G 4: 118,231,669 Y646H probably damaging Het
Rab3ip A T 10: 116,937,633 S92T probably benign Het
Rabgef1 A G 5: 130,187,351 probably benign Het
Ralgapa1 C A 12: 55,709,004 W1129L probably damaging Het
Rhpn2 T A 7: 35,385,463 L594Q probably benign Het
Rnf38 C A 4: 44,158,989 probably benign Het
Ryr2 T A 13: 11,738,194 H1747L possibly damaging Het
Sec16a A G 2: 26,439,717 L13P unknown Het
Sppl3 C A 5: 115,082,335 T102K probably damaging Het
Srgap2 A T 1: 131,291,613 Y264* probably null Het
Stxbp2 T C 8: 3,641,151 M465T Het
Sumf2 A G 5: 129,862,710 K305R probably benign Het
Susd2 T A 10: 75,642,565 Y59F probably benign Het
Taco1 T C 11: 106,072,617 V198A probably benign Het
Tas2r136 A T 6: 132,777,906 M86K possibly damaging Het
Tbc1d10c T C 19: 4,184,898 E388G possibly damaging Het
Tmem132c C T 5: 127,564,059 T1098I possibly damaging Het
Trim3 G T 7: 105,617,800 Y457* probably null Het
Ttc38 A G 15: 85,852,861 T316A probably benign Het
Ubqln4 T A 3: 88,555,910 N127K probably benign Het
Wdr91 A T 6: 34,904,626 F262Y probably damaging Het
Zdhhc6 A T 19: 55,302,755 C343S possibly damaging Het
Zfp248 A G 6: 118,430,209 C140R probably damaging Het
Zfp266 T C 9: 20,502,095 T90A probably benign Het
Zfp407 A T 18: 84,559,042 D1315E possibly damaging Het
Zfp644 T C 5: 106,638,277 S135G probably benign Het
Zscan29 A T 2: 121,160,988 I773N probably damaging Het
Zswim5 T A 4: 116,980,834 V787E possibly damaging Het
Other mutations in Nrcam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Nrcam APN 12 44575884 missense probably benign 0.27
IGL01657:Nrcam APN 12 44559800 missense probably damaging 1.00
IGL02434:Nrcam APN 12 44590243 splice site probably benign
IGL02455:Nrcam APN 12 44570530 missense probably damaging 1.00
IGL02712:Nrcam APN 12 44573827 missense probably damaging 1.00
IGL02834:Nrcam APN 12 44541075 critical splice donor site probably null
IGL03022:Nrcam APN 12 44598442 missense probably damaging 1.00
IGL03174:Nrcam APN 12 44576006 splice site probably benign
IGL03389:Nrcam APN 12 44549906 missense probably benign 0.00
IGL03397:Nrcam APN 12 44559757 missense probably damaging 1.00
I2288:Nrcam UTSW 12 44564315 missense probably benign 0.06
I2289:Nrcam UTSW 12 44564315 missense probably benign 0.06
R0063:Nrcam UTSW 12 44550028 missense possibly damaging 0.49
R0063:Nrcam UTSW 12 44550028 missense possibly damaging 0.49
R0195:Nrcam UTSW 12 44584845 missense probably benign 0.00
R0463:Nrcam UTSW 12 44551341 missense probably damaging 1.00
R0590:Nrcam UTSW 12 44564032 missense probably damaging 1.00
R0674:Nrcam UTSW 12 44564322 missense probably benign 0.17
R0930:Nrcam UTSW 12 44549884 missense probably benign
R1241:Nrcam UTSW 12 44590164 missense probably damaging 1.00
R1279:Nrcam UTSW 12 44544877 unclassified probably null
R1523:Nrcam UTSW 12 44572249 missense probably damaging 1.00
R1572:Nrcam UTSW 12 44537364 splice site probably benign
R1629:Nrcam UTSW 12 44563986 missense probably benign 0.00
R1651:Nrcam UTSW 12 44576679 missense probably damaging 0.97
R1729:Nrcam UTSW 12 44573850 missense probably benign
R1739:Nrcam UTSW 12 44571675 missense probably damaging 1.00
R1803:Nrcam UTSW 12 44572208 missense probably benign
R1884:Nrcam UTSW 12 44544755 missense probably damaging 1.00
R1974:Nrcam UTSW 12 44563993 missense probably benign 0.05
R1992:Nrcam UTSW 12 44540970 missense probably damaging 1.00
R2102:Nrcam UTSW 12 44576688 missense probably benign 0.00
R2106:Nrcam UTSW 12 44570290 missense probably benign 0.12
R3854:Nrcam UTSW 12 44575884 missense probably benign 0.27
R4005:Nrcam UTSW 12 44532646 missense probably benign
R4088:Nrcam UTSW 12 44572202 missense possibly damaging 0.93
R4115:Nrcam UTSW 12 44566326 missense possibly damaging 0.87
R4428:Nrcam UTSW 12 44576775 missense possibly damaging 0.95
R4458:Nrcam UTSW 12 44559730 missense probably damaging 1.00
R4580:Nrcam UTSW 12 44562540 critical splice donor site probably null
R4601:Nrcam UTSW 12 44591056 missense probably damaging 1.00
R4688:Nrcam UTSW 12 44547237 missense probably benign
R4825:Nrcam UTSW 12 44575986 nonsense probably null
R4838:Nrcam UTSW 12 44574019 missense probably damaging 1.00
R4950:Nrcam UTSW 12 44598490 missense probably damaging 1.00
R4960:Nrcam UTSW 12 44566299 missense probably benign 0.01
R5081:Nrcam UTSW 12 44570353 missense probably benign 0.00
R5297:Nrcam UTSW 12 44544784 missense probably damaging 1.00
R5504:Nrcam UTSW 12 44564132 critical splice donor site probably null
R5593:Nrcam UTSW 12 44559700 missense probably damaging 1.00
R5654:Nrcam UTSW 12 44564058 missense probably benign
R5691:Nrcam UTSW 12 44564256 missense probably damaging 1.00
R5890:Nrcam UTSW 12 44576771 missense probably benign
R5937:Nrcam UTSW 12 44572291 missense probably benign 0.00
R5980:Nrcam UTSW 12 44571633 missense probably damaging 1.00
R6132:Nrcam UTSW 12 44570224 missense probably damaging 1.00
R6213:Nrcam UTSW 12 44562432 missense possibly damaging 0.90
R6334:Nrcam UTSW 12 44572300 missense probably benign
R6617:Nrcam UTSW 12 44540963 missense probably damaging 1.00
R6666:Nrcam UTSW 12 44571555 missense probably damaging 1.00
R7191:Nrcam UTSW 12 44572244 missense probably benign 0.01
R7284:Nrcam UTSW 12 44564034 missense probably damaging 1.00
R7388:Nrcam UTSW 12 44598489 missense probably damaging 1.00
R7650:Nrcam UTSW 12 44547322 missense probably damaging 1.00
R7734:Nrcam UTSW 12 44537251 missense possibly damaging 0.49
R7840:Nrcam UTSW 12 44541075 critical splice donor site probably null
R7923:Nrcam UTSW 12 44541075 critical splice donor site probably null
U24488:Nrcam UTSW 12 44537259 missense probably damaging 1.00
X0057:Nrcam UTSW 12 44551416 missense probably benign
X0066:Nrcam UTSW 12 44550029 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTTCAGGTTTTGGACAAGGC -3'
(R):5'- GGCAAAGCTGGAGAATTTGTTC -3'

Sequencing Primer
(F):5'- TCAACAGATGTTTTCATGTCCAC -3'
(R):5'- AAGCTGGAGAATTTGTTCCACGTC -3'
Posted On2019-09-13