Incidental Mutation 'R7384:Eya1'
ID572913
Institutional Source Beutler Lab
Gene Symbol Eya1
Ensembl Gene ENSMUSG00000025932
Gene NameEYA transcriptional coactivator and phosphatase 1
Synonymsbor
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.861) question?
Stock #R7384 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location14168954-14310235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14229512 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 339 (Y339F)
Ref Sequence ENSEMBL: ENSMUSP00000126383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027066] [ENSMUST00000080664] [ENSMUST00000168081] [ENSMUST00000190337]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027066
AA Change: Y343F

PolyPhen 2 Score 0.525 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027066
Gene: ENSMUSG00000025932
AA Change: Y343F

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 56 75 N/A INTRINSIC
low complexity region 240 252 N/A INTRINSIC
low complexity region 295 319 N/A INTRINSIC
PDB:3HB1|D 320 591 1e-172 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000080664
AA Change: Y310F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079493
Gene: ENSMUSG00000025932
AA Change: Y310F

DomainStartEndE-ValueType
low complexity region 22 41 N/A INTRINSIC
low complexity region 201 213 N/A INTRINSIC
low complexity region 256 280 N/A INTRINSIC
PDB:3HB1|D 281 552 1e-173 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000168081
AA Change: Y339F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126383
Gene: ENSMUSG00000025932
AA Change: Y339F

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
low complexity region 207 219 N/A INTRINSIC
low complexity region 262 286 N/A INTRINSIC
PDB:3HB1|D 287 558 1e-172 PDB
Predicted Effect
Predicted Effect possibly damaging
Transcript: ENSMUST00000190337
AA Change: Y343F

PolyPhen 2 Score 0.525 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141112
Gene: ENSMUSG00000025932
AA Change: Y343F

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 56 75 N/A INTRINSIC
low complexity region 240 252 N/A INTRINSIC
low complexity region 295 319 N/A INTRINSIC
PDB:3HB1|D 320 591 1e-172 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may play a role in the developing kidney, branchial arches, eye, and ear. Mutations of this gene have been associated with branchiootorenal dysplasia syndrome, branchiootic syndrome, and sporadic cases of congenital cataracts and ocular anterior segment anomalies. A similar protein in mice can act as a transcriptional activator. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mutations in this locus affect inner ear morphology and hearing, and result in dysmorphic or absent kidneys. Hypomorphs are deaf and circle. Null homozygotes additionally show agenesis of thymus and parathyroid and thyroid hypoplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,463,468 probably null Het
Abca13 C A 11: 9,333,257 S3226R probably damaging Het
Abhd14b A G 9: 106,450,141 I41V probably benign Het
Acot2 T C 12: 83,992,667 S317P probably benign Het
Acp7 T C 7: 28,615,088 E284G possibly damaging Het
Adamts5 A G 16: 85,899,826 F148L probably benign Het
Adcy10 C T 1: 165,576,608 P1611S unknown Het
Agr2 A G 12: 35,995,924 T57A probably damaging Het
Ankar T G 1: 72,658,465 I1060L probably benign Het
Ano10 T A 9: 122,176,343 D77V unknown Het
Apc2 G A 10: 80,312,624 V1171I probably damaging Het
Apoa4 G A 9: 46,241,474 R19Q not run Het
Arhgap33 A G 7: 30,527,271 S504P probably damaging Het
Atg2a T C 19: 6,261,677 V1862A probably damaging Het
Atp7b T C 8: 22,022,315 S511G probably benign Het
Bcl10 A G 3: 145,933,040 K146E possibly damaging Het
Bsg A T 10: 79,709,797 D181V probably damaging Het
Btg4 T C 9: 51,119,113 V171A probably benign Het
Cdh8 A C 8: 99,230,506 N188K probably benign Het
Cflar C A 1: 58,752,576 T346K Het
Chrna5 T C 9: 55,004,833 S306P probably damaging Het
Cldn20 G A 17: 3,532,611 G20R probably damaging Het
Clns1a G A 7: 97,696,781 A18T probably benign Het
D130043K22Rik A G 13: 24,882,605 Y795C probably damaging Het
Dync1li2 A C 8: 104,442,543 S38A probably benign Het
Dysf A G 6: 84,114,105 E1043G probably benign Het
Eral1 A G 11: 78,074,101 I422T possibly damaging Het
Exoc3 G A 13: 74,172,156 P729S probably benign Het
Faah G T 4: 116,005,167 N206K probably damaging Het
Fem1a A G 17: 56,257,537 E210G probably benign Het
Gcc2 T A 10: 58,269,964 S341T probably damaging Het
Gfpt2 A T 11: 49,810,990 I123F possibly damaging Het
Gm21188 T A 13: 120,035,261 Q24L possibly damaging Het
Gm3047 T A 14: 4,558,271 N164K probably damaging Het
Gm3327 A G 14: 44,124,877 K78E Het
Gm438 T A 4: 144,780,621 I65F possibly damaging Het
Herpud1 A G 8: 94,389,377 I57V probably damaging Het
Homer1 A T 13: 93,393,039 R285S possibly damaging Het
Hps6 T A 19: 46,004,017 V131E possibly damaging Het
Il1r1 T A 1: 40,282,261 I11N possibly damaging Het
Jakmip1 T A 5: 37,173,207 D410E possibly damaging Het
Kif3a T A 11: 53,578,854 F97L probably damaging Het
Klf11 C T 12: 24,653,743 T76I probably damaging Het
Ldlr A C 9: 21,739,794 T503P probably benign Het
Mapk3 G C 7: 126,764,291 R279P Het
Mb21d2 A T 16: 28,828,912 D103E probably benign Het
Mfsd7a A T 5: 108,446,060 I61K probably damaging Het
Msh4 T A 3: 153,888,748 M333L probably benign Het
Mycbp2 A G 14: 103,276,393 I836T probably damaging Het
Myh1 A T 11: 67,224,375 E1912V possibly damaging Het
Ncapd2 A G 6: 125,173,401 V887A probably benign Het
Nlrp4a G A 7: 26,449,538 R190Q not run Het
Nop53 T C 7: 15,939,495 T344A probably damaging Het
Olfr235 T C 19: 12,269,076 V282A possibly damaging Het
Olfr457 A T 6: 42,471,323 L285Q possibly damaging Het
Olfr871 A G 9: 20,212,745 Y132C probably damaging Het
Pcyox1l A C 18: 61,698,390 V266G probably damaging Het
Pde5a A G 3: 122,825,000 Y654C probably damaging Het
Polq T C 16: 37,029,418 S345P probably damaging Het
Prdm1 A T 10: 44,458,507 C8S probably benign Het
Psg17 T A 7: 18,818,660 Q230L possibly damaging Het
Rab11fip5 A T 6: 85,348,330 S332T possibly damaging Het
Rac2 T A 15: 78,561,931 K186* probably null Het
S100pbp T C 4: 129,181,909 N208D probably benign Het
Scaf11 A T 15: 96,420,387 V432D possibly damaging Het
Slc34a1 G T 13: 55,402,934 C225F probably benign Het
Slc35e2 A T 4: 155,610,632 M152L probably benign Het
Slc9a4 T A 1: 40,612,251 I563K probably benign Het
Sppl3 T G 5: 115,061,641 probably null Het
Stam T C 2: 14,134,430 F301L probably benign Het
Supt16 G A 14: 52,181,162 R213W probably damaging Het
Tbc1d8 A T 1: 39,394,098 D334E probably benign Het
Tmem87a C T 2: 120,371,523 probably null Het
Tnk1 T C 11: 69,851,621 Y661C probably damaging Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Tnxb A G 17: 34,718,518 D2947G probably damaging Het
Traf4 A G 11: 78,160,791 probably null Het
Trappc10 A T 10: 78,209,384 M490K possibly damaging Het
Trav12-1 A G 14: 53,538,536 T49A probably benign Het
Ttc37 A C 13: 76,150,735 S1187R possibly damaging Het
Twistnb G T 12: 33,433,632 G128W probably damaging Het
Ubap1l AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 9: 65,371,750 probably benign Het
Unc79 G T 12: 103,171,578 V2485L probably benign Het
Ush2a T C 1: 188,400,163 S861P probably damaging Het
Vcam1 A G 3: 116,117,228 V507A possibly damaging Het
Vmn1r218 A G 13: 23,136,725 M81V probably benign Het
Zfp652 G T 11: 95,753,004 V343L probably damaging Het
Other mutations in Eya1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Eya1 APN 1 14270701 splice site probably benign
IGL01110:Eya1 APN 1 14283130 missense probably damaging 1.00
IGL02266:Eya1 APN 1 14184501 missense possibly damaging 0.63
IGL03027:Eya1 APN 1 14170966 missense probably damaging 1.00
IGL03081:Eya1 APN 1 14183191 missense possibly damaging 0.76
IGL03291:Eya1 APN 1 14184348 critical splice donor site probably null
IGL03353:Eya1 APN 1 14179527 missense probably damaging 1.00
R0042:Eya1 UTSW 1 14184489 missense probably damaging 0.98
R0042:Eya1 UTSW 1 14184489 missense probably damaging 0.98
R1428:Eya1 UTSW 1 14304414 splice site probably benign
R1521:Eya1 UTSW 1 14274550 missense probably damaging 0.99
R1571:Eya1 UTSW 1 14208917 missense probably damaging 1.00
R1768:Eya1 UTSW 1 14253075 missense possibly damaging 0.95
R1785:Eya1 UTSW 1 14170974 missense probably benign 0.16
R1840:Eya1 UTSW 1 14229504 nonsense probably null
R2114:Eya1 UTSW 1 14270774 missense probably damaging 1.00
R2131:Eya1 UTSW 1 14170974 missense probably benign 0.16
R2212:Eya1 UTSW 1 14274209 critical splice acceptor site probably null
R2416:Eya1 UTSW 1 14270703 critical splice donor site probably null
R2424:Eya1 UTSW 1 14270848 splice site probably benign
R3085:Eya1 UTSW 1 14274090 missense probably benign 0.01
R3158:Eya1 UTSW 1 14304467 start gained probably benign
R3412:Eya1 UTSW 1 14274209 critical splice acceptor site probably null
R3413:Eya1 UTSW 1 14274209 critical splice acceptor site probably null
R3693:Eya1 UTSW 1 14229501 missense probably damaging 1.00
R3694:Eya1 UTSW 1 14229501 missense probably damaging 1.00
R3899:Eya1 UTSW 1 14270747 missense probably benign 0.04
R4454:Eya1 UTSW 1 14183196 missense probably damaging 0.98
R4455:Eya1 UTSW 1 14183196 missense probably damaging 0.98
R4456:Eya1 UTSW 1 14183196 missense probably damaging 0.98
R4458:Eya1 UTSW 1 14183196 missense probably damaging 0.98
R4761:Eya1 UTSW 1 14302821 missense probably damaging 1.00
R5011:Eya1 UTSW 1 14184358 missense probably damaging 1.00
R5013:Eya1 UTSW 1 14184358 missense probably damaging 1.00
R5613:Eya1 UTSW 1 14302929 intron probably benign
R5687:Eya1 UTSW 1 14183252 missense probably damaging 0.99
R6052:Eya1 UTSW 1 14283150 missense probably damaging 1.00
R6181:Eya1 UTSW 1 14302872 missense probably damaging 0.99
R6378:Eya1 UTSW 1 14302803 missense possibly damaging 0.93
R6805:Eya1 UTSW 1 14183277 missense probably benign 0.00
R6863:Eya1 UTSW 1 14270975 intron probably null
R7032:Eya1 UTSW 1 14283200 critical splice acceptor site probably null
R7044:Eya1 UTSW 1 14231410 splice site probably null
R7078:Eya1 UTSW 1 14231412 critical splice donor site probably null
R7179:Eya1 UTSW 1 14302852 missense probably damaging 1.00
R7462:Eya1 UTSW 1 14231414 missense probably null 0.99
Z1176:Eya1 UTSW 1 14252430 missense probably benign
Z1176:Eya1 UTSW 1 14302868 missense probably damaging 1.00
Z1177:Eya1 UTSW 1 14184429 missense probably damaging 0.98
Z1177:Eya1 UTSW 1 14253090 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TTCGTGCAGGGAGACAAAGC -3'
(R):5'- ACCTGACAGTTGGGAGATGC -3'

Sequencing Primer
(F):5'- GCATAAGCTGAATGGAATCTGTCTC -3'
(R):5'- TGCCCTTAGGAAAAGCTGAGTG -3'
Posted On2019-09-13