Mutagenetix > Incidental Mutations

Incidental Mutation 'R7384:Adamts5'

572993

Institutional Source

Beutler Lab

Gene Symbol

Adamts5

Ensembl Gene

ENSMUSG00000022894

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)

Synonyms

9530092O11Rik, ADAM-TS5

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.320) question?

Stock #

R7384 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

85856173-85901828 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 85899826 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 148 (F148L)

Ref Sequence

ENSEMBL: ENSMUSP00000023611 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023611]

Predicted Effect

probably benign
Transcript: ENSMUST00000023611
AA Change: F148L

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000023611
Gene: ENSMUSG00000022894
AA Change: F148L

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Pep_M12B_propep	41	182	9.1e-18	PFAM
low complexity region	226	232	N/A	INTRINSIC
Pfam:Reprolysin_5	265	450	2.1e-16	PFAM
Pfam:Reprolysin_4	265	472	4.8e-14	PFAM
Pfam:Reprolysin	267	476	4.6e-26	PFAM
Pfam:Reprolysin_2	286	466	3.7e-13	PFAM
Pfam:Reprolysin_3	288	421	6.9e-17	PFAM
Blast:ACR	477	555	4e-15	BLAST
low complexity region	556	566	N/A	INTRINSIC
TSP1	570	622	6.04e-13	SMART
Pfam:ADAM_spacer1	732	852	1.7e-35	PFAM
TSP1	878	926	7.12e-2	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. Mice lacking the encoded protein are protected from surgery-induced osteoarthritis and antigen-induced arthritis. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit a significant reduction in cartilage degradation after induction of osteoarthritis whereas those homozygous for another show no affect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	A	T	3: 108,463,468		probably null	Het
Abca13	C	A	11: 9,333,257	S3226R	probably damaging	Het
Abhd14b	A	G	9: 106,450,141	I41V	probably benign	Het
Acot2	T	C	12: 83,992,667	S317P	probably benign	Het
Acp7	T	C	7: 28,615,088	E284G	possibly damaging	Het
Adcy10	C	T	1: 165,576,608	P1611S	unknown	Het
Agr2	A	G	12: 35,995,924	T57A	probably damaging	Het
Ankar	T	G	1: 72,658,465	I1060L	probably benign	Het
Ano10	T	A	9: 122,176,343	D77V	unknown	Het
Apc2	G	A	10: 80,312,624	V1171I	probably damaging	Het
Apoa4	G	A	9: 46,241,474	R19Q	not run	Het
Arhgap33	A	G	7: 30,527,271	S504P	probably damaging	Het
Atg2a	T	C	19: 6,261,677	V1862A	probably damaging	Het
Atp7b	T	C	8: 22,022,315	S511G	probably benign	Het
Bcl10	A	G	3: 145,933,040	K146E	possibly damaging	Het
Bsg	A	T	10: 79,709,797	D181V	probably damaging	Het
Btg4	T	C	9: 51,119,113	V171A	probably benign	Het
Cdh8	A	C	8: 99,230,506	N188K	probably benign	Het
Cflar	C	A	1: 58,752,576	T346K		Het
Chrna5	T	C	9: 55,004,833	S306P	probably damaging	Het
Cldn20	G	A	17: 3,532,611	G20R	probably damaging	Het
Clns1a	G	A	7: 97,696,781	A18T	probably benign	Het
D130043K22Rik	A	G	13: 24,882,605	Y795C	probably damaging	Het
Dync1li2	A	C	8: 104,442,543	S38A	probably benign	Het
Dysf	A	G	6: 84,114,105	E1043G	probably benign	Het
Eral1	A	G	11: 78,074,101	I422T	possibly damaging	Het
Exoc3	G	A	13: 74,172,156	P729S	probably benign	Het
Eya1	T	A	1: 14,229,512	Y339F	probably damaging	Het
Faah	G	T	4: 116,005,167	N206K	probably damaging	Het
Fem1a	A	G	17: 56,257,537	E210G	probably benign	Het
Gcc2	T	A	10: 58,269,964	S341T	probably damaging	Het
Gfpt2	A	T	11: 49,810,990	I123F	possibly damaging	Het
Gm21188	T	A	13: 120,035,261	Q24L	possibly damaging	Het
Gm3047	T	A	14: 4,558,271	N164K	probably damaging	Het
Gm3327	A	G	14: 44,124,877	K78E		Het
Gm438	T	A	4: 144,780,621	I65F	possibly damaging	Het
Herpud1	A	G	8: 94,389,377	I57V	probably damaging	Het
Homer1	A	T	13: 93,393,039	R285S	possibly damaging	Het
Hps6	T	A	19: 46,004,017	V131E	possibly damaging	Het
Il1r1	T	A	1: 40,282,261	I11N	possibly damaging	Het
Jakmip1	T	A	5: 37,173,207	D410E	possibly damaging	Het
Kif3a	T	A	11: 53,578,854	F97L	probably damaging	Het
Klf11	C	T	12: 24,653,743	T76I	probably damaging	Het
Ldlr	A	C	9: 21,739,794	T503P	probably benign	Het
Mapk3	G	C	7: 126,764,291	R279P		Het
Mb21d2	A	T	16: 28,828,912	D103E	probably benign	Het
Mfsd7a	A	T	5: 108,446,060	I61K	probably damaging	Het
Msh4	T	A	3: 153,888,748	M333L	probably benign	Het
Mycbp2	A	G	14: 103,276,393	I836T	probably damaging	Het
Myh1	A	T	11: 67,224,375	E1912V	possibly damaging	Het
Ncapd2	A	G	6: 125,173,401	V887A	probably benign	Het
Nlrp4a	G	A	7: 26,449,538	R190Q	not run	Het
Nop53	T	C	7: 15,939,495	T344A	probably damaging	Het
Olfr235	T	C	19: 12,269,076	V282A	possibly damaging	Het
Olfr457	A	T	6: 42,471,323	L285Q	possibly damaging	Het
Olfr871	A	G	9: 20,212,745	Y132C	probably damaging	Het
Pcyox1l	A	C	18: 61,698,390	V266G	probably damaging	Het
Pde5a	A	G	3: 122,825,000	Y654C	probably damaging	Het
Polq	T	C	16: 37,029,418	S345P	probably damaging	Het
Prdm1	A	T	10: 44,458,507	C8S	probably benign	Het
Psg17	T	A	7: 18,818,660	Q230L	possibly damaging	Het
Rab11fip5	A	T	6: 85,348,330	S332T	possibly damaging	Het
Rac2	T	A	15: 78,561,931	K186*	probably null	Het
S100pbp	T	C	4: 129,181,909	N208D	probably benign	Het
Scaf11	A	T	15: 96,420,387	V432D	possibly damaging	Het
Slc34a1	G	T	13: 55,402,934	C225F	probably benign	Het
Slc35e2	A	T	4: 155,610,632	M152L	probably benign	Het
Slc9a4	T	A	1: 40,612,251	I563K	probably benign	Het
Sppl3	T	G	5: 115,061,641		probably null	Het
Stam	T	C	2: 14,134,430	F301L	probably benign	Het
Supt16	G	A	14: 52,181,162	R213W	probably damaging	Het
Tbc1d8	A	T	1: 39,394,098	D334E	probably benign	Het
Tmem87a	C	T	2: 120,371,523		probably null	Het
Tnk1	T	C	11: 69,851,621	Y661C	probably damaging	Het
Tnpo2	G	A	8: 85,050,119	R485H	probably damaging	Het
Tnxb	A	G	17: 34,718,518	D2947G	probably damaging	Het
Traf4	A	G	11: 78,160,791		probably null	Het
Trappc10	A	T	10: 78,209,384	M490K	possibly damaging	Het
Trav12-1	A	G	14: 53,538,536	T49A	probably benign	Het
Ttc37	A	C	13: 76,150,735	S1187R	possibly damaging	Het
Twistnb	G	T	12: 33,433,632	G128W	probably damaging	Het
Ubap1l	AGAGGAGGAGGAGGAGGA	AGAGGAGGAGGAGGA	9: 65,371,750		probably benign	Het
Unc79	G	T	12: 103,171,578	V2485L	probably benign	Het
Ush2a	T	C	1: 188,400,163	S861P	probably damaging	Het
Vcam1	A	G	3: 116,117,228	V507A	possibly damaging	Het
Vmn1r218	A	G	13: 23,136,725	M81V	probably benign	Het
Zfp652	G	T	11: 95,753,004	V343L	probably damaging	Het

Other mutations in Adamts5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01063:Adamts5	APN	16	85899834	missense	probably damaging	1.00
IGL01070:Adamts5	APN	16	85863133	missense	probably damaging	1.00
IGL01321:Adamts5	APN	16	85899475	missense	probably benign	0.03
IGL01616:Adamts5	APN	16	85887814	splice site	probably null
IGL02551:Adamts5	APN	16	85870038	missense	possibly damaging	0.71
IGL03263:Adamts5	APN	16	85869942	missense	probably damaging	0.99
IGL03295:Adamts5	APN	16	85877945	missense	probably damaging	1.00
IGL03393:Adamts5	APN	16	85868195	missense	probably damaging	0.99
IGL03403:Adamts5	APN	16	85863014	missense	probably damaging	0.97
R0414:Adamts5	UTSW	16	85877906	missense	probably damaging	1.00
R0419:Adamts5	UTSW	16	85866642	missense	probably benign	0.00
R0539:Adamts5	UTSW	16	85868692	missense	probably damaging	1.00
R0570:Adamts5	UTSW	16	85899247	missense	probably damaging	1.00
R0574:Adamts5	UTSW	16	85899484	missense	probably damaging	0.99
R0669:Adamts5	UTSW	16	85899726	missense	probably benign	0.45
R1454:Adamts5	UTSW	16	85869993	missense	possibly damaging	0.88
R1498:Adamts5	UTSW	16	85900102	missense	possibly damaging	0.63
R1729:Adamts5	UTSW	16	85877915	nonsense	probably null
R1753:Adamts5	UTSW	16	85899352	missense	probably damaging	1.00
R1784:Adamts5	UTSW	16	85877915	nonsense	probably null
R1906:Adamts5	UTSW	16	85868685	nonsense	probably null
R1946:Adamts5	UTSW	16	85899243	missense	probably damaging	1.00
R2180:Adamts5	UTSW	16	85887924	missense	probably damaging	1.00
R2223:Adamts5	UTSW	16	85899306	missense	probably damaging	1.00
R2366:Adamts5	UTSW	16	85862758	missense	probably damaging	1.00
R3889:Adamts5	UTSW	16	85868121	missense	probably damaging	1.00
R4214:Adamts5	UTSW	16	85868643	missense	probably damaging	1.00
R4909:Adamts5	UTSW	16	85900066	nonsense	probably null
R5119:Adamts5	UTSW	16	85899578	missense	probably benign	0.00
R5230:Adamts5	UTSW	16	85870068	missense	probably damaging	0.97
R5452:Adamts5	UTSW	16	85869912	critical splice donor site	probably null
R5652:Adamts5	UTSW	16	85899268	missense	probably damaging	1.00
R5831:Adamts5	UTSW	16	85868118	missense	probably damaging	1.00
R6045:Adamts5	UTSW	16	85899300	missense	probably damaging	0.99
R6259:Adamts5	UTSW	16	85899753	missense	probably benign	0.03
R6384:Adamts5	UTSW	16	85862828	missense	probably benign	0.00
R6724:Adamts5	UTSW	16	85868557	missense	probably benign	0.06
R6829:Adamts5	UTSW	16	85870071	missense	possibly damaging	0.52
R7066:Adamts5	UTSW	16	85862764	missense	probably damaging	1.00
R7256:Adamts5	UTSW	16	85863035	missense	probably damaging	1.00
R7293:Adamts5	UTSW	16	85899945	missense	probably benign	0.10
R7298:Adamts5	UTSW	16	85899918	missense	probably benign	0.35
R7452:Adamts5	UTSW	16	85877981	missense	probably benign	0.00
R7727:Adamts5	UTSW	16	85899966	missense	probably damaging	1.00
R7785:Adamts5	UTSW	16	85863004	missense	probably damaging	0.99
R7894:Adamts5	UTSW	16	85877920	nonsense	probably null
R8111:Adamts5	UTSW	16	85899315	missense	probably damaging	1.00
X0062:Adamts5	UTSW	16	85863157	missense	probably damaging	1.00
Z1177:Adamts5	UTSW	16	85870074	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTAGATCTACTGTGCACCGAGG -3'
(R):5'- AAGTGGGCTACCTTGTCTACG -3'

Sequencing Primer
(F):5'- ATGCAGGAGTCTCGCAACTG -3'
(R):5'- TACCTTGTCTACGCGGGC -3'

Posted On

2019-09-13