Incidental Mutation 'R7386:Rnf2'
ID573075
Institutional Source Beutler Lab
Gene Symbol Rnf2
Ensembl Gene ENSMUSG00000026484
Gene Namering finger protein 2
SynonymsdinG, Ring1B
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7386 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location151458004-151500955 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 151471380 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 316 (E316G)
Ref Sequence ENSEMBL: ENSMUSP00000075476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076110] [ENSMUST00000186415] [ENSMUST00000187048] [ENSMUST00000190070]
PDB Structure
RING1B-BMI1 E3 CATALYTIC DOMAIN STRUCTURE [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000076110
AA Change: E316G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075476
Gene: ENSMUSG00000026484
AA Change: E316G

DomainStartEndE-ValueType
RING 51 90 1.7e-7 SMART
Pfam:RAWUL 234 330 1.3e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186415
AA Change: E244G

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140594
Gene: ENSMUSG00000026484
AA Change: E244G

DomainStartEndE-ValueType
RING 51 110 3.24e-4 SMART
PDB:3H8H|A 148 258 4e-78 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000187048
AA Change: E316G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140896
Gene: ENSMUSG00000026484
AA Change: E316G

DomainStartEndE-ValueType
RING 51 90 1.7e-7 SMART
PDB:3H8H|A 220 330 4e-77 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000190070
SMART Domains Protein: ENSMUSP00000139676
Gene: ENSMUSG00000026484

DomainStartEndE-ValueType
Blast:RING 1 35 7e-16 BLAST
PDB:3H8H|A 73 156 2e-56 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polycomb group (PcG) of proteins form the multiprotein complexes that are important for the transcription repression of various genes involved in development and cell proliferation. The protein encoded by this gene is one of the PcG proteins. It has been shown to interact with, and suppress the activity of, transcription factor CP2 (TFCP2/CP2). Studies of the mouse counterpart suggested the involvement of this gene in the specification of anterior-posterior axis, as well as in cell proliferation in early development. This protein was also found to interact with huntingtin interacting protein 2 (HIP2), an ubiquitin-conjugating enzyme, and possess ubiquitin ligase activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a null allele show an early growth arrest, failure to progress through gastrulation, impaired epiblast expansion, accumulation of posterior mesoderm and die before E10.5. Mice homozygous for a hypomorphic allele show posterior homeotic transformations of the axial skeleton. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930546C10Rik A T 18: 68,950,137 M2K unknown Het
6430531B16Rik A T 7: 139,976,052 C225* probably null Het
Ablim3 T C 18: 61,821,994 D308G probably damaging Het
Adamts17 A T 7: 66,968,849 K370N probably benign Het
Adcy4 T C 14: 55,778,327 Y435C probably damaging Het
Adgb A T 10: 10,377,949 F1216I possibly damaging Het
Akr1a1 G A 4: 116,641,054 T98I probably damaging Het
Alyref2 G T 1: 171,503,533 probably benign Het
Ank3 T A 10: 69,822,249 H168Q unknown Het
Bnc1 A C 7: 81,974,492 L329R possibly damaging Het
Btaf1 G A 19: 36,958,382 A191T probably benign Het
Carmil3 T G 14: 55,497,747 probably null Het
Cd200r1 C A 16: 44,789,848 D143E probably benign Het
Cep112 A G 11: 108,808,681 H98R probably benign Het
Cmya5 T A 13: 93,069,323 Q3346L probably damaging Het
Cpne4 T A 9: 104,872,740 V81E possibly damaging Het
Ctnnd2 T A 15: 30,966,768 M955K probably damaging Het
Ctsj A T 13: 61,000,559 M307K possibly damaging Het
Ddhd2 G T 8: 25,754,290 R103S possibly damaging Het
Depdc5 A G 5: 32,927,936 T700A probably benign Het
Dhx57 A C 17: 80,267,577 D657E possibly damaging Het
Dmbt1 G A 7: 131,112,236 G1678S unknown Het
Dnajb1 A G 8: 83,610,303 D234G probably benign Het
Dsc2 C T 18: 20,041,926 V431M possibly damaging Het
Evi5 C A 5: 107,809,823 probably null Het
Exoc2 T C 13: 30,906,663 probably null Het
Foxo3 T C 10: 42,197,360 D387G probably benign Het
Gda A G 19: 21,409,886 I325T probably benign Het
Gm960 G A 19: 4,663,558 R285* probably null Het
Iqgap1 A G 7: 80,726,042 S1362P probably damaging Het
Klf10 G T 15: 38,296,949 N282K possibly damaging Het
Mettl13 A G 1: 162,548,154 Y35H probably damaging Het
Mill2 A G 7: 18,858,290 T279A probably benign Het
Ncaph2 G A 15: 89,370,256 W386* probably null Het
Nploc4 A T 11: 120,408,881 S338T probably benign Het
Nrip1 T C 16: 76,293,887 S261G probably damaging Het
Olfr1042 A G 2: 86,159,530 V280A possibly damaging Het
Olfr1354 T A 10: 78,916,843 M1K probably null Het
Olfr1388 T C 11: 49,444,400 F183S possibly damaging Het
Palld A G 8: 61,532,052 F1060L unknown Het
Pfas C G 11: 69,003,774 V22L probably benign Het
Pygo2 T G 3: 89,432,821 F175L probably benign Het
Rtn4 T A 11: 29,707,772 M642K probably damaging Het
Saa3 A G 7: 46,714,923 C60R unknown Het
Scap A G 9: 110,373,169 T202A probably benign Het
Scn9a T A 2: 66,540,550 D562V probably damaging Het
Slc6a19 A T 13: 73,689,891 V163E possibly damaging Het
Smc5 G A 19: 23,215,175 H850Y possibly damaging Het
Sqle G A 15: 59,330,754 R519Q probably benign Het
Sulf1 T C 1: 12,838,361 Y533H probably benign Het
Tex45 A G 8: 3,487,079 K475R probably benign Het
Thbs2 A G 17: 14,673,150 S923P possibly damaging Het
Themis A G 10: 28,789,747 D602G probably benign Het
Tmem132c A G 5: 127,563,926 K1054E probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tnrc6c T A 11: 117,721,954 C313S probably benign Het
Tpm1 T C 9: 67,028,167 I284M probably benign Het
Trpm4 A T 7: 45,314,640 L722H possibly damaging Het
Trub2 T G 2: 29,786,595 Q41P probably benign Het
Usp17le A C 7: 104,768,307 probably null Het
Zfp398 G A 6: 47,858,950 V148I probably benign Het
Zfp40 T C 17: 23,177,007 E202G probably damaging Het
Zfp618 T A 4: 63,095,385 probably null Het
Zfp667 T A 7: 6,305,950 I539N possibly damaging Het
Zfp738 A T 13: 67,670,250 C541S probably damaging Het
Other mutations in Rnf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02515:Rnf2 APN 1 151471695 missense probably benign 0.03
R1913:Rnf2 UTSW 1 151476185 missense probably damaging 1.00
R4333:Rnf2 UTSW 1 151473076 missense possibly damaging 0.68
R4965:Rnf2 UTSW 1 151473217 nonsense probably null
R6323:Rnf2 UTSW 1 151473216 missense probably damaging 0.98
R6886:Rnf2 UTSW 1 151473266 missense possibly damaging 0.85
R7474:Rnf2 UTSW 1 151471716 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAACTGAACATATCCCAGGTCTG -3'
(R):5'- CAATGCCTGTTGAGCTCCTTG -3'

Sequencing Primer
(F):5'- TATCCCAGGTCTGTCCATGAAAG -3'
(R):5'- CCTGTTGAGCTCCTTGGCTAG -3'
Posted On2019-09-13