Incidental Mutation 'R7407:Flrt2'
ID574806
Institutional Source Beutler Lab
Gene Symbol Flrt2
Ensembl Gene ENSMUSG00000047414
Gene Namefibronectin leucine rich transmembrane protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7407 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location95692226-95785215 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95779300 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 137 (E137D)
Ref Sequence ENSEMBL: ENSMUSP00000062171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057324] [ENSMUST00000110117]
Predicted Effect probably damaging
Transcript: ENSMUST00000057324
AA Change: E137D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062171
Gene: ENSMUSG00000047414
AA Change: E137D

DomainStartEndE-ValueType
LRRNT 35 67 1.51e-4 SMART
LRR 107 131 1.29e1 SMART
LRR 132 157 4.32e0 SMART
LRR 159 181 6.78e1 SMART
LRR 182 202 6.97e1 SMART
LRR 203 228 7.16e0 SMART
LRR 252 274 5.26e0 SMART
LRR_TYP 275 298 2.43e-4 SMART
LRRCT 310 361 1.17e-7 SMART
low complexity region 368 400 N/A INTRINSIC
FN3 420 502 5.07e0 SMART
transmembrane domain 542 564 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110117
AA Change: E137D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105744
Gene: ENSMUSG00000047414
AA Change: E137D

DomainStartEndE-ValueType
LRRNT 35 67 1.51e-4 SMART
LRR 107 131 1.29e1 SMART
LRR 132 157 4.32e0 SMART
LRR 159 181 6.78e1 SMART
LRR 182 202 6.97e1 SMART
LRR 203 228 7.16e0 SMART
LRR 252 274 5.26e0 SMART
LRR_TYP 275 298 2.43e-4 SMART
LRRCT 310 361 1.17e-7 SMART
low complexity region 368 400 N/A INTRINSIC
FN3 420 502 5.07e0 SMART
transmembrane domain 542 564 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fibronectin leucine rich transmembrane (FLRT) family of cell adhesion molecules, which regulate early embryonic vascular and neural development. The encoded type I transmembrane protein has an extracellular region consisting of an N-terminal leucine-rich repeat domain and a type 3 fibronectin domain, followed by a transmembrane domain and a short C-terminal cytoplasmic tail domain. It functions as both a homophilic cell adhesion molecule and a heterophilic chemorepellent through its interaction with members of the uncoordinated-5 receptor family. Proteolytic removal of the extracellular region controls the migration of neurons in the developing cortex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic, fetal, and postnatel lethality with few mice surviving to weaning due to defects in epicardium, myocardium, and endocardium development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405O20Rik A G 7: 50,599,878 N220S probably damaging Het
Abcb8 T C 5: 24,400,676 V186A probably benign Het
Actbl2 A T 13: 111,256,218 E362D probably damaging Het
Adamts17 C A 7: 67,047,556 Y28* probably null Het
Agtr1b T C 3: 20,315,731 D237G possibly damaging Het
Amer2 A G 14: 60,378,842 D162G probably damaging Het
Ankub1 T C 3: 57,665,203 E366G probably benign Het
Ap5z1 A G 5: 142,466,575 I88V probably benign Het
BC053393 A G 11: 46,577,390 Y97C probably damaging Het
Ccdc186 T C 19: 56,813,385 N100S probably benign Het
Cldn19 A G 4: 119,255,685 D38G probably damaging Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Deaf1 G A 7: 141,297,579 A545V possibly damaging Het
Dicer1 G T 12: 104,722,351 Y322* probably null Het
Dnajb7 G T 15: 81,407,626 T170K possibly damaging Het
Galnt12 T C 4: 47,120,362 F482L probably damaging Het
Gm14025 A G 2: 129,038,809 I399T Het
Gm32742 A G 9: 51,156,674 V336A probably damaging Het
Gpatch8 G A 11: 102,479,830 R961W unknown Het
Hcn4 A G 9: 58,859,370 E738G unknown Het
Kdelr3 A G 15: 79,524,838 Y76C probably damaging Het
Krt77 T C 15: 101,860,095 S494G unknown Het
Letmd1 G T 15: 100,469,238 A39S probably benign Het
Lrrc7 G A 3: 158,135,241 R1387W probably damaging Het
Meltf T C 16: 31,894,735 Y599H probably damaging Het
Mybpc1 T A 10: 88,549,347 I477L probably damaging Het
Nf1 A G 11: 79,448,143 D1174G probably damaging Het
Olfr720 T A 14: 14,175,402 I227L probably benign Het
Olfr907 T A 9: 38,499,504 Y278* probably null Het
Palld G T 8: 61,515,941 S1283* probably null Het
Pcmtd2 T C 2: 181,846,605 V183A possibly damaging Het
Pcsk5 T A 19: 17,675,516 I269F probably damaging Het
Pkd1 T C 17: 24,594,594 L4036P probably damaging Het
Pkhd1l1 A G 15: 44,595,011 N4151S possibly damaging Het
Rcor3 C T 1: 192,101,672 S422N probably benign Het
Rhag A G 17: 40,831,334 I223V possibly damaging Het
Ssbp4 A G 8: 70,599,022 Y231H probably damaging Het
Syce1l C T 8: 113,655,138 Q237* probably null Het
Tenm4 T C 7: 96,773,987 V663A possibly damaging Het
Trim6 T C 7: 104,225,901 I115T probably damaging Het
Vmn1r25 T A 6: 57,979,059 T82S possibly damaging Het
Vmn2r28 A G 7: 5,481,309 S631P probably damaging Het
Xpo1 T A 11: 23,285,823 V637E probably damaging Het
Xpo6 A T 7: 126,171,052 M62K probably damaging Het
Ypel5 A G 17: 72,846,379 N26S possibly damaging Het
Zbtb24 C A 10: 41,464,779 Q624K possibly damaging Het
Zfp629 T C 7: 127,610,243 D798G probably benign Het
Zfp687 C T 3: 95,007,530 R1220H probably damaging Het
Other mutations in Flrt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Flrt2 APN 12 95780529 missense probably damaging 1.00
IGL01083:Flrt2 APN 12 95780347 missense probably benign 0.05
IGL01410:Flrt2 APN 12 95779192 missense probably damaging 1.00
IGL01601:Flrt2 APN 12 95779595 missense probably damaging 0.99
IGL01800:Flrt2 APN 12 95779688 missense probably damaging 1.00
IGL01940:Flrt2 APN 12 95780238 missense probably damaging 1.00
IGL02224:Flrt2 APN 12 95780028 missense possibly damaging 0.58
IGL02272:Flrt2 APN 12 95779704 missense probably damaging 1.00
IGL02452:Flrt2 APN 12 95779483 missense probably benign 0.01
R0966:Flrt2 UTSW 12 95780301 missense possibly damaging 0.70
R1066:Flrt2 UTSW 12 95779059 missense probably damaging 1.00
R1218:Flrt2 UTSW 12 95778953 missense probably benign 0.00
R1442:Flrt2 UTSW 12 95780205 missense probably damaging 1.00
R1462:Flrt2 UTSW 12 95779338 missense probably damaging 1.00
R1462:Flrt2 UTSW 12 95779338 missense probably damaging 1.00
R1746:Flrt2 UTSW 12 95780792 missense possibly damaging 0.90
R1842:Flrt2 UTSW 12 95779284 missense probably damaging 1.00
R1901:Flrt2 UTSW 12 95779130 missense probably damaging 1.00
R1901:Flrt2 UTSW 12 95779131 missense probably damaging 1.00
R1959:Flrt2 UTSW 12 95780300 missense probably benign 0.01
R2310:Flrt2 UTSW 12 95780090 missense probably benign 0.01
R3418:Flrt2 UTSW 12 95780604 missense probably damaging 1.00
R3419:Flrt2 UTSW 12 95780604 missense probably damaging 1.00
R4412:Flrt2 UTSW 12 95780273 missense probably benign
R4617:Flrt2 UTSW 12 95780229 missense possibly damaging 0.96
R4674:Flrt2 UTSW 12 95780688 nonsense probably null
R5001:Flrt2 UTSW 12 95778951 missense probably benign
R5009:Flrt2 UTSW 12 95779773 missense probably damaging 0.98
R5150:Flrt2 UTSW 12 95779203 missense possibly damaging 0.84
R5179:Flrt2 UTSW 12 95780347 missense probably benign 0.05
R5269:Flrt2 UTSW 12 95779938 missense possibly damaging 0.46
R5535:Flrt2 UTSW 12 95780426 missense probably benign 0.08
R6172:Flrt2 UTSW 12 95779531 missense probably damaging 1.00
R6180:Flrt2 UTSW 12 95779238 nonsense probably null
R6867:Flrt2 UTSW 12 95779382 missense probably damaging 1.00
R6986:Flrt2 UTSW 12 95780685 missense probably damaging 1.00
R7379:Flrt2 UTSW 12 95780555 missense possibly damaging 0.68
R7711:Flrt2 UTSW 12 95780754 missense probably damaging 1.00
R8065:Flrt2 UTSW 12 95780774 missense probably benign 0.00
R8109:Flrt2 UTSW 12 95780559 missense probably benign 0.00
R8306:Flrt2 UTSW 12 95779302 missense probably damaging 1.00
Z1176:Flrt2 UTSW 12 95778912 missense possibly damaging 0.76
Z1176:Flrt2 UTSW 12 95779559 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAGCTGCACAATGTCCAG -3'
(R):5'- GAAGATTCCCATCCACGATCAGG -3'

Sequencing Primer
(F):5'- TGCACAATGTCCAGTCAGTG -3'
(R):5'- CCATGTCTGATATGACGGCAATTCG -3'
Posted On2019-10-07