Incidental Mutation 'R7407:Ccdc186'
ID574821
Institutional Source Beutler Lab
Gene Symbol Ccdc186
Ensembl Gene ENSMUSG00000035173
Gene Namecoiled-coil domain containing 186
SynonymsOtg1, A630007B06Rik, 1810028B20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7407 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location56787481-56822190 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56813385 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 100 (N100S)
Ref Sequence ENSEMBL: ENSMUSP00000075454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076085] [ENSMUST00000118592]
Predicted Effect probably benign
Transcript: ENSMUST00000076085
AA Change: N100S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000075454
Gene: ENSMUSG00000035173
AA Change: N100S

DomainStartEndE-ValueType
internal_repeat_1 7 104 8.63e-6 PROSPERO
internal_repeat_1 119 216 8.63e-6 PROSPERO
low complexity region 252 264 N/A INTRINSIC
low complexity region 426 447 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 619 631 N/A INTRINSIC
low complexity region 641 651 N/A INTRINSIC
low complexity region 656 670 N/A INTRINSIC
Blast:SPEC 671 799 1e-37 BLAST
coiled coil region 874 913 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118592
AA Change: N100S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113457
Gene: ENSMUSG00000035173
AA Change: N100S

DomainStartEndE-ValueType
internal_repeat_1 7 104 8.63e-6 PROSPERO
internal_repeat_1 119 216 8.63e-6 PROSPERO
low complexity region 252 264 N/A INTRINSIC
low complexity region 426 447 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 619 631 N/A INTRINSIC
low complexity region 641 651 N/A INTRINSIC
low complexity region 656 670 N/A INTRINSIC
Blast:SPEC 671 799 1e-37 BLAST
coiled coil region 874 913 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405O20Rik A G 7: 50,599,878 N220S probably damaging Het
Abcb8 T C 5: 24,400,676 V186A probably benign Het
Actbl2 A T 13: 111,256,218 E362D probably damaging Het
Adamts17 C A 7: 67,047,556 Y28* probably null Het
Agtr1b T C 3: 20,315,731 D237G possibly damaging Het
Amer2 A G 14: 60,378,842 D162G probably damaging Het
Ankub1 T C 3: 57,665,203 E366G probably benign Het
Ap5z1 A G 5: 142,466,575 I88V probably benign Het
BC053393 A G 11: 46,577,390 Y97C probably damaging Het
Cldn19 A G 4: 119,255,685 D38G probably damaging Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Deaf1 G A 7: 141,297,579 A545V possibly damaging Het
Dicer1 G T 12: 104,722,351 Y322* probably null Het
Dnajb7 G T 15: 81,407,626 T170K possibly damaging Het
Flrt2 A T 12: 95,779,300 E137D probably damaging Het
Galnt12 T C 4: 47,120,362 F482L probably damaging Het
Gm14025 A G 2: 129,038,809 I399T Het
Gm32742 A G 9: 51,156,674 V336A probably damaging Het
Gpatch8 G A 11: 102,479,830 R961W unknown Het
Hcn4 A G 9: 58,859,370 E738G unknown Het
Kdelr3 A G 15: 79,524,838 Y76C probably damaging Het
Krt77 T C 15: 101,860,095 S494G unknown Het
Letmd1 G T 15: 100,469,238 A39S probably benign Het
Lrrc7 G A 3: 158,135,241 R1387W probably damaging Het
Meltf T C 16: 31,894,735 Y599H probably damaging Het
Mybpc1 T A 10: 88,549,347 I477L probably damaging Het
Nf1 A G 11: 79,448,143 D1174G probably damaging Het
Olfr720 T A 14: 14,175,402 I227L probably benign Het
Olfr907 T A 9: 38,499,504 Y278* probably null Het
Palld G T 8: 61,515,941 S1283* probably null Het
Pcmtd2 T C 2: 181,846,605 V183A possibly damaging Het
Pcsk5 T A 19: 17,675,516 I269F probably damaging Het
Pkd1 T C 17: 24,594,594 L4036P probably damaging Het
Pkhd1l1 A G 15: 44,595,011 N4151S possibly damaging Het
Rcor3 C T 1: 192,101,672 S422N probably benign Het
Rhag A G 17: 40,831,334 I223V possibly damaging Het
Ssbp4 A G 8: 70,599,022 Y231H probably damaging Het
Syce1l C T 8: 113,655,138 Q237* probably null Het
Tenm4 T C 7: 96,773,987 V663A possibly damaging Het
Trim6 T C 7: 104,225,901 I115T probably damaging Het
Vmn1r25 T A 6: 57,979,059 T82S possibly damaging Het
Vmn2r28 A G 7: 5,481,309 S631P probably damaging Het
Xpo1 T A 11: 23,285,823 V637E probably damaging Het
Xpo6 A T 7: 126,171,052 M62K probably damaging Het
Ypel5 A G 17: 72,846,379 N26S possibly damaging Het
Zbtb24 C A 10: 41,464,779 Q624K possibly damaging Het
Zfp629 T C 7: 127,610,243 D798G probably benign Het
Zfp687 C T 3: 95,007,530 R1220H probably damaging Het
Other mutations in Ccdc186
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Ccdc186 APN 19 56813447 missense probably benign 0.18
IGL00976:Ccdc186 APN 19 56797500 missense probably damaging 1.00
IGL01146:Ccdc186 APN 19 56809317 missense probably damaging 1.00
IGL01316:Ccdc186 APN 19 56813413 missense probably benign 0.01
IGL01627:Ccdc186 APN 19 56792020 missense probably damaging 1.00
IGL02325:Ccdc186 APN 19 56813356 missense probably benign 0.03
IGL02755:Ccdc186 APN 19 56813396 missense probably benign 0.06
IGL02899:Ccdc186 APN 19 56793488 missense probably benign 0.00
IGL03408:Ccdc186 APN 19 56798731 missense probably benign 0.00
receding UTSW 19 56800129 missense probably damaging 1.00
R1256:Ccdc186 UTSW 19 56797621 missense probably benign 0.20
R1728:Ccdc186 UTSW 19 56809220 missense probably benign 0.04
R1729:Ccdc186 UTSW 19 56809220 missense probably benign 0.04
R1784:Ccdc186 UTSW 19 56809220 missense probably benign 0.04
R1813:Ccdc186 UTSW 19 56800169 missense probably benign 0.03
R1909:Ccdc186 UTSW 19 56793361 missense probably damaging 1.00
R2110:Ccdc186 UTSW 19 56800142 missense possibly damaging 0.80
R2319:Ccdc186 UTSW 19 56797567 missense possibly damaging 0.50
R2351:Ccdc186 UTSW 19 56798697 missense possibly damaging 0.89
R2970:Ccdc186 UTSW 19 56806998 missense probably damaging 1.00
R4159:Ccdc186 UTSW 19 56793492 nonsense probably null
R4898:Ccdc186 UTSW 19 56802000 splice site probably null
R4910:Ccdc186 UTSW 19 56798691 missense probably damaging 0.98
R5325:Ccdc186 UTSW 19 56813181 missense probably damaging 0.99
R5338:Ccdc186 UTSW 19 56813257 missense possibly damaging 0.87
R5662:Ccdc186 UTSW 19 56793488 missense probably benign
R5773:Ccdc186 UTSW 19 56813487 missense probably benign 0.06
R6621:Ccdc186 UTSW 19 56813487 missense probably benign 0.06
R6806:Ccdc186 UTSW 19 56800129 missense probably damaging 1.00
R6908:Ccdc186 UTSW 19 56791939 critical splice donor site probably null
R6977:Ccdc186 UTSW 19 56798787 missense probably benign 0.05
R7108:Ccdc186 UTSW 19 56798760 missense probably damaging 1.00
R7190:Ccdc186 UTSW 19 56792000 missense probably damaging 1.00
R7408:Ccdc186 UTSW 19 56808178 missense probably damaging 1.00
R7437:Ccdc186 UTSW 19 56806997 missense probably damaging 1.00
R8219:Ccdc186 UTSW 19 56793345 missense probably benign 0.42
RF014:Ccdc186 UTSW 19 56813472 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTGAAACAGTCTTCATCTCGG -3'
(R):5'- GGATGACTCGTGCATCTCAG -3'

Sequencing Primer
(F):5'- ACAGTCTTCATCTCGGAAATGAG -3'
(R):5'- CATCTCAGTTTCTGGTGACGAAAGC -3'
Posted On2019-10-07