Incidental Mutation 'R7421:Fcer2a'
ID575661
Institutional Source Beutler Lab
Gene Symbol Fcer2a
Ensembl Gene ENSMUSG00000005540
Gene NameFc receptor, IgE, low affinity II, alpha polypeptide
SynonymsLy-42, FC epsilon RII, CD23, Fce2, low-affinity IgE receptor
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7421 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location3681737-3694175 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3690335 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 4 (H4L)
Ref Sequence ENSEMBL: ENSMUSP00000146647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005678] [ENSMUST00000207463] [ENSMUST00000207635] [ENSMUST00000208145] [ENSMUST00000208438] [ENSMUST00000208492] [ENSMUST00000208603]
Predicted Effect probably benign
Transcript: ENSMUST00000005678
SMART Domains Protein: ENSMUSP00000005678
Gene: ENSMUSG00000005540

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
coiled coil region 80 150 N/A INTRINSIC
CLECT 186 306 2.11e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207463
Predicted Effect probably benign
Transcript: ENSMUST00000207635
Predicted Effect probably benign
Transcript: ENSMUST00000208145
AA Change: H4L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000208438
Predicted Effect probably benign
Transcript: ENSMUST00000208492
Predicted Effect probably benign
Transcript: ENSMUST00000208603
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a B-cell specific antigen, and a low-affinity receptor for IgE. It has essential roles in B cell growth and differentiation, and the regulation of IgE production. This protein also exists as a soluble secreted form, then functioning as a potent mitogenic growth factor. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for mutations in this gene are essentially normal although IgE levels or IgE mediated responses may be abnormal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aar2 T C 2: 156,555,995 I309T possibly damaging Het
Abca12 A C 1: 71,247,136 L2513* probably null Het
Abca13 G C 11: 9,510,463 V4158L probably benign Het
Acaca A G 11: 84,363,736 T1880A possibly damaging Het
Arhgap5 C T 12: 52,518,000 R585C probably benign Het
Arsk A C 13: 76,062,515 I471S possibly damaging Het
Asb7 T C 7: 66,660,120 D116G probably damaging Het
Atad2 A G 15: 58,134,926 S17P probably benign Het
Atf5 T C 7: 44,815,138 E10G probably damaging Het
B3gntl1 G T 11: 121,624,178 P255T probably benign Het
Cacna1s A G 1: 136,086,802 N649S probably damaging Het
Ccnc A G 4: 21,743,291 Y192C probably damaging Het
Cd28 A G 1: 60,763,300 N126S probably benign Het
Cep57 A G 9: 13,810,673 S360P possibly damaging Het
Ces1e C T 8: 93,215,075 V257I probably benign Het
Chd1 A G 17: 15,749,398 K913R probably benign Het
Cluap1 A T 16: 3,940,793 D373V probably damaging Het
Cnmd T C 14: 79,645,507 I160V probably benign Het
Col6a4 G A 9: 106,020,795 P1686S probably damaging Het
Coro7 G T 16: 4,668,751 A186E probably benign Het
Cuta T C 17: 26,939,457 probably benign Het
Dnah2 G A 11: 69,492,805 H1098Y probably benign Het
Duox1 T A 2: 122,323,230 C345S probably damaging Het
Ephb4 T A 5: 137,354,425 I90K possibly damaging Het
Erich3 T A 3: 154,733,561 M280K probably damaging Het
Grk1 A T 8: 13,405,316 I67F probably damaging Het
Grm8 A C 6: 27,762,477 S250A possibly damaging Het
H2-Q6 A G 17: 35,425,228 E62G possibly damaging Het
Inppl1 C T 7: 101,832,937 R144H probably damaging Het
Itga3 G T 11: 95,068,855 P33Q probably benign Het
Itgax G A 7: 128,140,432 S672N probably damaging Het
Itpk1 A T 12: 102,574,065 V253E possibly damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Mrps7 T C 11: 115,604,891 V85A probably benign Het
Muc2 T C 7: 141,748,126 L427P Het
Mum1 T A 10: 80,232,753 S244T probably benign Het
Myef2 G T 2: 125,110,617 Q185K probably benign Het
Olfr1249 T A 2: 89,630,571 D109V probably damaging Het
Olfr22-ps1 G T 11: 73,955,509 C273F unknown Het
Pcdh15 G A 10: 74,454,065 M905I possibly damaging Het
Pgm5 C T 19: 24,709,299 V515M probably benign Het
Pik3r1 A G 13: 101,689,136 I381T probably damaging Het
Pla2g4f A G 2: 120,307,256 M341T probably benign Het
Prmt2 A G 10: 76,221,078 F204L probably benign Het
Rasa2 A G 9: 96,611,447 V50A unknown Het
Scn7a A C 2: 66,675,532 I1671S probably benign Het
Sco2 G A 15: 89,371,720 R244C possibly damaging Het
Slfn1 A G 11: 83,121,141 M28V possibly damaging Het
Slfn9 A T 11: 82,981,371 C846* probably null Het
Slfn9 A G 11: 82,987,736 I189T probably damaging Het
Svil T A 18: 5,056,109 S327R probably benign Het
Tcaf3 A T 6: 42,596,842 N145K probably benign Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ttc37 A T 13: 76,148,825 K1100N probably benign Het
Tusc5 G A 11: 76,694,225 R147Q unknown Het
Upp2 G T 2: 58,771,574 V130F possibly damaging Het
Vnn3 G A 10: 23,865,768 A324T probably benign Het
Wasf2 A G 4: 133,185,101 E88G unknown Het
Zfp39 A T 11: 58,890,107 C610S probably damaging Het
Other mutations in Fcer2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Fcer2a APN 8 3688842 missense possibly damaging 0.94
IGL01458:Fcer2a APN 8 3688151 missense probably benign 0.45
IGL01545:Fcer2a APN 8 3683598 nonsense probably null
IGL01994:Fcer2a APN 8 3688302 missense possibly damaging 0.94
IGL03340:Fcer2a APN 8 3688310 missense possibly damaging 0.75
anemone UTSW 8 3688796 critical splice donor site probably null
R0058:Fcer2a UTSW 8 3688111 splice site probably benign
R0058:Fcer2a UTSW 8 3688111 splice site probably benign
R0241:Fcer2a UTSW 8 3688796 critical splice donor site probably null
R0241:Fcer2a UTSW 8 3688796 critical splice donor site probably null
R0276:Fcer2a UTSW 8 3689811 missense possibly damaging 0.89
R1530:Fcer2a UTSW 8 3682976 missense probably damaging 0.98
R2202:Fcer2a UTSW 8 3688557 missense possibly damaging 0.72
R4133:Fcer2a UTSW 8 3691130 missense possibly damaging 0.60
R4249:Fcer2a UTSW 8 3688831 missense probably benign 0.00
R4273:Fcer2a UTSW 8 3682848 missense possibly damaging 0.81
R4506:Fcer2a UTSW 8 3688603 splice site probably null
R6796:Fcer2a UTSW 8 3689830 missense possibly damaging 0.92
R6861:Fcer2a UTSW 8 3682910 missense probably damaging 0.98
R7795:Fcer2a UTSW 8 3682910 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAATATTGATGGGCACATGCG -3'
(R):5'- AGAGTTGAGACTTGGGGACC -3'

Sequencing Primer
(F):5'- ACATGCGGGTATGGGCTC -3'
(R):5'- AAAAGGGTGGGTCTCAGCTTC -3'
Posted On2019-10-07