Mutagenetix > Incidental Mutations

Incidental Mutation 'R7457:Tspan12'

578194

Institutional Source

Beutler Lab

Gene Symbol

Tspan12

Ensembl Gene

ENSMUSG00000029669

Gene Name

tetraspanin 12

Synonyms

Tm4sf12

MMRRC Submission

Accession Numbers

Genbank: NM_173007; MGI: 1889818

Is this an essential gene?

Probably non essential (E-score: 0.107) question?

Stock #

R7457 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

21771395-21852515 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 21772683 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 289 (H289L)

Ref Sequence

ENSEMBL: ENSMUSP00000031678 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031678] [ENSMUST00000120965]

Predicted Effect

probably benign
Transcript: ENSMUST00000031678
AA Change: H289L

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000031678
Gene: ENSMUSG00000029669
AA Change: H289L

Domain	Start	End	E-Value	Type
Pfam:Tetraspannin	9	248	1.1e-42	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000120965
AA Change: H241L

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000113384
Gene: ENSMUSG00000029669
AA Change: H241L

Domain	Start	End	E-Value	Type
Pfam:Tetraspannin	9	156	4.1e-23	PFAM
transmembrane domain	180	202	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal retinal vasculature with pericapillary occlusions, lack of vertical sprouts, gliosis, fenestration, microanurysms, hemorrhage, and delayed regression of hyaloid capillaries. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam32	A	T	8: 24,884,619	H452Q	probably damaging	Het
Adcy8	A	T	15: 64,920,680	N142K	possibly damaging	Het
Alkbh8	T	A	9: 3,343,056	S57R	probably damaging	Het
Atp4a	A	G	7: 30,720,767	T780A	probably benign	Het
Atp9b	A	T	18: 80,917,618		probably null	Het
Cdyl2	A	T	8: 116,579,196	V442E	probably damaging	Het
Ces2a	C	T	8: 104,737,389	R218C	possibly damaging	Het
Cfap57	A	T	4: 118,589,001	V688E	probably damaging	Het
Clec11a	T	C	7: 44,305,955	T139A	probably benign	Het
Clstn1	A	T	4: 149,634,916	T411S	probably benign	Het
Commd5	A	T	15: 76,900,624	S74C	probably damaging	Het
Cyp3a59	C	A	5: 146,104,750	P368Q	probably damaging	Het
Dennd4b	A	G	3: 90,269,315	M309V	probably benign	Het
Dhrs9	T	A	2: 69,401,267	V257E	probably benign	Het
Dhx16	T	C	17: 35,891,060	V993A	probably damaging	Het
Dok5	A	T	2: 170,870,815	Q247L	probably benign	Het
E330034G19Rik	A	T	14: 24,309,514	E331V	unknown	Het
Efs	A	G	14: 54,919,994	S287P	probably benign	Het
Fbn1	T	C	2: 125,351,747	N1384S	possibly damaging	Het
Flt4	A	G	11: 49,630,328	E388G	possibly damaging	Het
Fmn2	T	A	1: 174,503,737		probably null	Het
Fmo4	T	C	1: 162,794,103	Y513C	probably benign	Het
Gbp4	T	C	5: 105,119,553	E500G	probably damaging	Het
Gm29106	T	C	1: 118,199,252	S225P	probably damaging	Het
Gstt2	G	A	10: 75,832,520	R134W	probably damaging	Het
Gucy1b2	T	C	14: 62,392,952	T782A	probably benign	Het
Gzf1	G	T	2: 148,690,082	R543L	probably damaging	Het
H2-Eb2	G	A	17: 34,334,347	G169E	probably damaging	Het
Hdhd3	T	A	4: 62,499,790	R50W	probably damaging	Het
Hdlbp	T	C	1: 93,428,222	K407E	probably benign	Het
Isl2	A	G	9: 55,544,956	T271A	probably benign	Het
Kbtbd7	GTCTCTC	GTC	14: 79,427,924		probably null	Het
Kdm4b	T	A	17: 56,396,319	N671K	probably damaging	Het
Lats1	T	A	10: 7,710,891	L939H	probably damaging	Het
Map3k1	A	T	13: 111,756,255	M822K	probably damaging	Het
Mettl18	C	A	1: 163,996,761	T217N	probably damaging	Het
Nav3	A	T	10: 109,696,328	Y2083*	probably null	Het
Nckap1l	T	C	15: 103,453,806		probably benign	Het
Nkx2-3	A	G	19: 43,612,547	D16G	probably damaging	Het
Nlrx1	A	G	9: 44,256,510	S697P	probably benign	Het
Olfr115	T	C	17: 37,610,565	K62R	possibly damaging	Het
Olfr389	G	C	11: 73,776,826	S167C	probably benign	Het
Olfr731	A	T	14: 50,238,368	N172K	probably damaging	Het
Olfr790	T	C	10: 129,501,706	V266A	probably damaging	Het
Pappa	A	T	4: 65,189,266	D638V	probably damaging	Het
Pot1a	T	C	6: 25,771,622	D200G	probably benign	Het
Ptprs	G	T	17: 56,419,502	T1366K	probably damaging	Het
Sass6	A	T	3: 116,620,164	R505S	probably benign	Het
Slc30a6	T	C	17: 74,407,238	I84T	probably benign	Het
Sox10	A	T	15: 79,156,139	F400L	probably benign	Het
Spata31d1b	A	T	13: 59,716,909	I624F	probably damaging	Het
Stpg4	A	G	17: 87,427,578		probably null	Het
Tbc1d9	G	T	8: 83,236,680	K340N	probably damaging	Het
Ubr1	T	A	2: 120,917,828	T809S	probably benign	Het
Vmn1r43	C	T	6: 89,870,190	V105M	probably damaging	Het
Vmn1r49	A	G	6: 90,072,552	V156A	probably benign	Het
Wnt5a	A	G	14: 28,518,279		probably null	Het
Wwp2	T	A	8: 107,517,960	S255T	probably benign	Het
Zbtb10	A	G	3: 9,251,478	T117A	possibly damaging	Het
Zfp800	C	T	6: 28,244,229	V246I	probably benign	Het
Zfp955a	G	T	17: 33,244,051	Y35*	probably null	Het

Other mutations in Tspan12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00843:Tspan12	APN	6	21851082	utr 5 prime	probably benign
IGL02601:Tspan12	APN	6	21835379	unclassified	probably benign
IGL02992:Tspan12	APN	6	21799877	critical splice donor site	probably null
PIT4362001:Tspan12	UTSW	6	21835464	missense	possibly damaging	0.87
R1800:Tspan12	UTSW	6	21795700	missense	probably damaging	1.00
R1862:Tspan12	UTSW	6	21851023	missense	probably damaging	1.00
R1898:Tspan12	UTSW	6	21795694	missense	probably damaging	0.97
R2101:Tspan12	UTSW	6	21799888	missense	probably benign	0.00
R2351:Tspan12	UTSW	6	21835507	missense	probably benign
R4820:Tspan12	UTSW	6	21795661	missense	probably damaging	0.99
R4921:Tspan12	UTSW	6	21835449	missense	possibly damaging	0.66
R5284:Tspan12	UTSW	6	21835467	missense	probably damaging	0.97
R5341:Tspan12	UTSW	6	21835459	missense	possibly damaging	0.69
R5372:Tspan12	UTSW	6	21772699	missense	probably benign	0.06
R5929:Tspan12	UTSW	6	21772747	missense	possibly damaging	0.92
R6052:Tspan12	UTSW	6	21772638	missense	probably benign	0.09
R6108:Tspan12	UTSW	6	21772771	missense	probably benign
R6207:Tspan12	UTSW	6	21799908	missense	probably damaging	1.00
R6248:Tspan12	UTSW	6	21799971	missense	probably damaging	1.00
R7014:Tspan12	UTSW	6	21772919	missense	probably benign	0.01
R7776:Tspan12	UTSW	6	21836443	missense	probably damaging	1.00
ZE80:Tspan12	UTSW	6	21795609	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- GTTCGGCATTTTGAAGGGCAC -3'
(R):5'- CACAAATCCTGGCCATGATTC -3'

Sequencing Primer
(F):5'- TCTGTGTATTACCATGTGGAACC -3'
(R):5'- AAATCCTGGCCATGATTCTCACC -3'

Posted On

2019-10-07