Incidental Mutation 'R7506:Tmem150a'
ID581784
Institutional Source Beutler Lab
Gene Symbol Tmem150a
Ensembl Gene ENSMUSG00000055912
Gene Nametransmembrane protein 150A
SynonymsTmem150
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.627) question?
Stock #R7506 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location72355447-72359762 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 72356770 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000063977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069580] [ENSMUST00000069595] [ENSMUST00000069695] [ENSMUST00000077783] [ENSMUST00000114095] [ENSMUST00000130064] [ENSMUST00000132243] [ENSMUST00000149296] [ENSMUST00000151063] [ENSMUST00000154098] [ENSMUST00000206064] [ENSMUST00000206531]
Predicted Effect probably benign
Transcript: ENSMUST00000069580
SMART Domains Protein: ENSMUSP00000066128
Gene: ENSMUSG00000055850

DomainStartEndE-ValueType
RING 88 128 5.51e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069595
SMART Domains Protein: ENSMUSP00000070370
Gene: ENSMUSG00000055850

DomainStartEndE-ValueType
RING 20 60 5.51e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000069695
SMART Domains Protein: ENSMUSP00000063977
Gene: ENSMUSG00000055912

DomainStartEndE-ValueType
Pfam:Frag1 3 232 3.8e-63 PFAM
low complexity region 251 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077783
SMART Domains Protein: ENSMUSP00000076957
Gene: ENSMUSG00000058706

DomainStartEndE-ValueType
Pfam:UPF0561 1 126 4.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114095
SMART Domains Protein: ENSMUSP00000109729
Gene: ENSMUSG00000055850

DomainStartEndE-ValueType
RING 88 155 2.82e-4 SMART
low complexity region 185 196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125554
Predicted Effect probably benign
Transcript: ENSMUST00000126065
Predicted Effect probably benign
Transcript: ENSMUST00000129233
Predicted Effect probably benign
Transcript: ENSMUST00000130064
SMART Domains Protein: ENSMUSP00000115187
Gene: ENSMUSG00000055850

DomainStartEndE-ValueType
RING 32 72 5.51e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000132243
SMART Domains Protein: ENSMUSP00000138445
Gene: ENSMUSG00000055912

DomainStartEndE-ValueType
Pfam:Frag1 3 69 7.2e-12 PFAM
low complexity region 139 154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149296
Predicted Effect probably benign
Transcript: ENSMUST00000151063
Predicted Effect probably benign
Transcript: ENSMUST00000154098
SMART Domains Protein: ENSMUSP00000138327
Gene: ENSMUSG00000055850

DomainStartEndE-ValueType
RING 41 81 5.51e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000206064
Predicted Effect probably benign
Transcript: ENSMUST00000206531
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik C T 9: 15,297,906 V31I probably benign Het
4933430I17Rik T C 4: 62,532,261 V24A possibly damaging Het
Adamtsl3 A T 7: 82,514,978 R334W probably damaging Het
Aox1 G A 1: 58,049,403 C116Y probably damaging Het
B3gntl1 A T 11: 121,670,914 I74N probably damaging Het
Bicra C T 7: 15,988,213 V460M possibly damaging Het
Ccdc18 G A 5: 108,163,739 C437Y possibly damaging Het
Cdh6 A G 15: 13,034,310 S755P probably damaging Het
Crtc2 G T 3: 90,259,212 A165S probably damaging Het
Cwf19l2 C T 9: 3,456,775 H703Y probably damaging Het
Cyc1 C A 15: 76,343,685 T41K probably benign Het
Defb28 A T 2: 152,518,301 H12L possibly damaging Het
Dsg3 T A 18: 20,533,464 C577S probably benign Het
Ggt6 G T 11: 72,437,898 C408F possibly damaging Het
Gm3278 T A 14: 4,893,441 Y97N probably damaging Het
Gpr155 A G 2: 73,368,339 L412P probably damaging Het
Gucd1 T C 10: 75,511,185 H77R probably benign Het
Hat1 T A 2: 71,420,347 I158N probably damaging Het
Hhla1 C T 15: 65,936,382 W271* probably null Het
Hist1h2bg G A 13: 23,571,484 A18T unknown Het
Igsf10 T A 3: 59,319,354 L2299F probably damaging Het
Iqsec1 G T 6: 90,662,806 H983Q possibly damaging Het
Iqsec1 A G 6: 90,667,909 S914P probably damaging Het
Irx2 G T 13: 72,629,209 G50C probably damaging Het
Kif26b T C 1: 178,529,499 probably benign Het
Lmo7 A G 14: 101,919,609 E1405G unknown Het
Mdm2 T C 10: 117,690,691 D330G possibly damaging Het
Mgat5 A C 1: 127,366,455 D178A probably benign Het
Mier2 C A 10: 79,550,342 R25L probably benign Het
Mlip T C 9: 77,164,803 K257E probably damaging Het
Mtfr2 T C 10: 20,353,385 S80P probably benign Het
Ndst2 A G 14: 20,730,085 V29A probably benign Het
Negr1 T G 3: 157,069,233 Y195* probably null Het
Nptn T C 9: 58,618,873 L101P probably damaging Het
Nrip1 G A 16: 76,294,459 T70I probably damaging Het
Nrtn C T 17: 56,751,633 V123M probably damaging Het
Olfr59 A T 11: 74,289,123 H159L possibly damaging Het
Onecut1 T A 9: 74,863,240 F315Y possibly damaging Het
P4htm A G 9: 108,583,679 L198S probably damaging Het
Pappa A C 4: 65,231,182 I920L probably benign Het
Pcdhgb5 A C 18: 37,732,472 D440A probably damaging Het
Ppard A T 17: 28,298,761 N268Y possibly damaging Het
Rapgef6 T A 11: 54,636,171 S563T probably benign Het
Rtn3 T A 19: 7,429,753 E949D probably benign Het
Sf3a1 T C 11: 4,177,561 M629T probably benign Het
Slc39a8 T C 3: 135,884,306 I319T probably benign Het
Sorcs1 C T 19: 50,182,674 W925* probably null Het
Spag9 G A 11: 94,108,464 D1069N probably damaging Het
Taar7a A G 10: 23,992,994 V163A possibly damaging Het
Tnxb G A 17: 34,715,691 V2425I possibly damaging Het
Tppp2 A G 14: 51,920,601 K168E possibly damaging Het
Ttn T A 2: 76,889,468 D7099V unknown Het
Vmn1r41 A T 6: 89,747,177 R50* probably null Het
Vmn1r60 T C 7: 5,544,862 K80E Het
Vmn2r18 A G 5: 151,585,020 F213S possibly damaging Het
Vmn2r26 G A 6: 124,039,741 S388N probably benign Het
Vmn2r63 A T 7: 42,926,967 F474Y probably damaging Het
Zc3hav1 G A 6: 38,332,940 R316* probably null Het
Zfp654 A T 16: 64,791,848 I225N probably damaging Het
Zfp97 A G 17: 17,145,280 E347G probably damaging Het
Other mutations in Tmem150a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Tmem150a APN 6 72357118 missense probably damaging 0.96
R0070:Tmem150a UTSW 6 72358759 splice site probably null
R0070:Tmem150a UTSW 6 72358759 splice site probably null
R4474:Tmem150a UTSW 6 72357052 missense probably benign 0.27
R6170:Tmem150a UTSW 6 72356745 missense probably benign 0.03
R7723:Tmem150a UTSW 6 72359074 missense probably damaging 0.96
R7751:Tmem150a UTSW 6 72359045 missense probably damaging 1.00
R7783:Tmem150a UTSW 6 72358623 missense unknown
R8078:Tmem150a UTSW 6 72358323 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTCTCTAGTGGAGGCAATTG -3'
(R):5'- ACCTTCCTGAAGCAGAAGC -3'

Sequencing Primer
(F):5'- GCTCCAGCATCAGTAACTACCTC -3'
(R):5'- CCTTCCTGAAGCAGAAGCAAAGAAG -3'
Posted On2019-10-17