Incidental Mutation 'R7506:Slc39a8'
ID581777
Institutional Source Beutler Lab
Gene Symbol Slc39a8
Ensembl Gene ENSMUSG00000053897
Gene Namesolute carrier family 39 (metal ion transporter), member 8
Synonyms4933419D20Rik, BIGM103, ZIP8
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7506 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location135825279-135888572 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135884306 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 319 (I319T)
Ref Sequence ENSEMBL: ENSMUSP00000029810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029810] [ENSMUST00000081978] [ENSMUST00000167390] [ENSMUST00000180196]
Predicted Effect probably benign
Transcript: ENSMUST00000029810
AA Change: I319T

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000029810
Gene: ENSMUSG00000053897
AA Change: I319T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Zip 126 453 6.2e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081978
AA Change: I319T

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000080640
Gene: ENSMUSG00000053897
AA Change: I319T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Zip 126 453 4.7e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167390
AA Change: I319T

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000128245
Gene: ENSMUSG00000053897
AA Change: I319T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Zip 126 453 4.7e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180196
AA Change: I319T

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000136634
Gene: ENSMUSG00000053897
AA Change: I319T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Zip 126 453 4.7e-72 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC39 family of solute-carrier genes, which show structural characteristics of zinc transporters. The encoded protein is glycosylated and found in the plasma membrane and mitochondria, and functions in the cellular import of zinc at the onset of inflammation. It is also thought to be the primary transporter of the toxic cation cadmium, which is found in cigarette smoke. Multiple transcript variants encoding different isoforms have been found for this gene. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik C T 9: 15,297,906 V31I probably benign Het
4933430I17Rik T C 4: 62,532,261 V24A possibly damaging Het
Adamtsl3 A T 7: 82,514,978 R334W probably damaging Het
Aox1 G A 1: 58,049,403 C116Y probably damaging Het
B3gntl1 A T 11: 121,670,914 I74N probably damaging Het
Bicra C T 7: 15,988,213 V460M possibly damaging Het
Ccdc18 G A 5: 108,163,739 C437Y possibly damaging Het
Cdh6 A G 15: 13,034,310 S755P probably damaging Het
Crtc2 G T 3: 90,259,212 A165S probably damaging Het
Cwf19l2 C T 9: 3,456,775 H703Y probably damaging Het
Cyc1 C A 15: 76,343,685 T41K probably benign Het
Defb28 A T 2: 152,518,301 H12L possibly damaging Het
Dsg3 T A 18: 20,533,464 C577S probably benign Het
Ggt6 G T 11: 72,437,898 C408F possibly damaging Het
Gm3278 T A 14: 4,893,441 Y97N probably damaging Het
Gpr155 A G 2: 73,368,339 L412P probably damaging Het
Gucd1 T C 10: 75,511,185 H77R probably benign Het
Hat1 T A 2: 71,420,347 I158N probably damaging Het
Hhla1 C T 15: 65,936,382 W271* probably null Het
Hist1h2bg G A 13: 23,571,484 A18T unknown Het
Igsf10 T A 3: 59,319,354 L2299F probably damaging Het
Iqsec1 G T 6: 90,662,806 H983Q possibly damaging Het
Iqsec1 A G 6: 90,667,909 S914P probably damaging Het
Irx2 G T 13: 72,629,209 G50C probably damaging Het
Kif26b T C 1: 178,529,499 probably benign Het
Lmo7 A G 14: 101,919,609 E1405G unknown Het
Mdm2 T C 10: 117,690,691 D330G possibly damaging Het
Mgat5 A C 1: 127,366,455 D178A probably benign Het
Mier2 C A 10: 79,550,342 R25L probably benign Het
Mlip T C 9: 77,164,803 K257E probably damaging Het
Mtfr2 T C 10: 20,353,385 S80P probably benign Het
Ndst2 A G 14: 20,730,085 V29A probably benign Het
Negr1 T G 3: 157,069,233 Y195* probably null Het
Nptn T C 9: 58,618,873 L101P probably damaging Het
Nrip1 G A 16: 76,294,459 T70I probably damaging Het
Nrtn C T 17: 56,751,633 V123M probably damaging Het
Olfr59 A T 11: 74,289,123 H159L possibly damaging Het
Onecut1 T A 9: 74,863,240 F315Y possibly damaging Het
P4htm A G 9: 108,583,679 L198S probably damaging Het
Pappa A C 4: 65,231,182 I920L probably benign Het
Pcdhgb5 A C 18: 37,732,472 D440A probably damaging Het
Ppard A T 17: 28,298,761 N268Y possibly damaging Het
Rapgef6 T A 11: 54,636,171 S563T probably benign Het
Rtn3 T A 19: 7,429,753 E949D probably benign Het
Sf3a1 T C 11: 4,177,561 M629T probably benign Het
Sorcs1 C T 19: 50,182,674 W925* probably null Het
Spag9 G A 11: 94,108,464 D1069N probably damaging Het
Taar7a A G 10: 23,992,994 V163A possibly damaging Het
Tmem150a G A 6: 72,356,770 probably null Het
Tnxb G A 17: 34,715,691 V2425I possibly damaging Het
Tppp2 A G 14: 51,920,601 K168E possibly damaging Het
Ttn T A 2: 76,889,468 D7099V unknown Het
Vmn1r41 A T 6: 89,747,177 R50* probably null Het
Vmn1r60 T C 7: 5,544,862 K80E Het
Vmn2r18 A G 5: 151,585,020 F213S possibly damaging Het
Vmn2r26 G A 6: 124,039,741 S388N probably benign Het
Vmn2r63 A T 7: 42,926,967 F474Y probably damaging Het
Zc3hav1 G A 6: 38,332,940 R316* probably null Het
Zfp654 A T 16: 64,791,848 I225N probably damaging Het
Zfp97 A G 17: 17,145,280 E347G probably damaging Het
Other mutations in Slc39a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Slc39a8 APN 3 135858112 missense probably benign
IGL00793:Slc39a8 APN 3 135884733 missense probably benign 0.00
IGL02591:Slc39a8 APN 3 135884620 missense probably damaging 1.00
IGL02868:Slc39a8 APN 3 135856026 missense probably damaging 1.00
IGL03062:Slc39a8 APN 3 135886797 splice site probably benign
IGL03144:Slc39a8 APN 3 135884210 missense probably benign 0.01
IGL03329:Slc39a8 APN 3 135884713 missense probably damaging 0.98
R1449:Slc39a8 UTSW 3 135826685 missense probably benign 0.41
R2869:Slc39a8 UTSW 3 135886793 splice site probably null
R2869:Slc39a8 UTSW 3 135886793 splice site probably null
R2870:Slc39a8 UTSW 3 135886793 splice site probably null
R2870:Slc39a8 UTSW 3 135886793 splice site probably null
R2871:Slc39a8 UTSW 3 135886793 splice site probably null
R2871:Slc39a8 UTSW 3 135886793 splice site probably null
R2872:Slc39a8 UTSW 3 135886793 splice site probably null
R2872:Slc39a8 UTSW 3 135886793 splice site probably null
R2873:Slc39a8 UTSW 3 135886793 splice site probably null
R2937:Slc39a8 UTSW 3 135886823 missense probably benign 0.00
R3832:Slc39a8 UTSW 3 135849133 missense probably damaging 0.96
R4669:Slc39a8 UTSW 3 135856011 missense probably benign 0.35
R5057:Slc39a8 UTSW 3 135849029 missense probably benign 0.00
R5098:Slc39a8 UTSW 3 135858157 missense probably benign 0.01
R5677:Slc39a8 UTSW 3 135884688 missense probably damaging 1.00
R6747:Slc39a8 UTSW 3 135849180 critical splice donor site probably null
R7181:Slc39a8 UTSW 3 135857538 missense possibly damaging 0.93
R7459:Slc39a8 UTSW 3 135886911 missense probably damaging 1.00
R7589:Slc39a8 UTSW 3 135884362 missense probably damaging 0.96
R7860:Slc39a8 UTSW 3 135884396 missense probably damaging 1.00
R8059:Slc39a8 UTSW 3 135826586 missense probably benign 0.00
R8096:Slc39a8 UTSW 3 135884656 missense probably damaging 1.00
R8144:Slc39a8 UTSW 3 135884643 nonsense probably null
R8218:Slc39a8 UTSW 3 135857564 missense probably benign 0.03
X0023:Slc39a8 UTSW 3 135826544 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAACAATTTGTCTCCCCTGGG -3'
(R):5'- ATTCATCTCCGTGTATGATTAGGG -3'

Sequencing Primer
(F):5'- ACAATTTGTCTCCCCTGGGACATAAC -3'
(R):5'- GGTCTGCCCAGTCTAACATTCG -3'
Posted On2019-10-17