Incidental Mutation 'R7564:Mtcl1'
ID 585338
Institutional Source Beutler Lab
Gene Symbol Mtcl1
Ensembl Gene ENSMUSG00000052105
Gene Name microtubule crosslinking factor 1
Synonyms 1110012J17Rik, Soga2, t8219b25
MMRRC Submission 045656-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.154) question?
Stock # R7564 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 66643977-66756745 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 66678322 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 668 (R668H)
Ref Sequence ENSEMBL: ENSMUSP00000135690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086693] [ENSMUST00000097291] [ENSMUST00000145347] [ENSMUST00000177034]
AlphaFold Q3UHU5
Predicted Effect probably benign
Transcript: ENSMUST00000086693
SMART Domains Protein: ENSMUSP00000083899
Gene: ENSMUSG00000052105

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
low complexity region 54 98 N/A INTRINSIC
low complexity region 99 120 N/A INTRINSIC
low complexity region 127 132 N/A INTRINSIC
low complexity region 166 183 N/A INTRINSIC
low complexity region 240 259 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
SCOP:d1fxkc_ 332 466 3e-7 SMART
Blast:BRLZ 339 362 1e-5 BLAST
Pfam:DUF3166 493 587 1.8e-34 PFAM
Pfam:DUF3166 622 714 3.8e-39 PFAM
low complexity region 843 859 N/A INTRINSIC
low complexity region 896 910 N/A INTRINSIC
low complexity region 962 973 N/A INTRINSIC
low complexity region 1049 1062 N/A INTRINSIC
coiled coil region 1120 1159 N/A INTRINSIC
Pfam:DUF4482 1220 1344 3e-40 PFAM
low complexity region 1464 1476 N/A INTRINSIC
low complexity region 1672 1681 N/A INTRINSIC
low complexity region 1912 1924 N/A INTRINSIC
low complexity region 1931 1943 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097291
SMART Domains Protein: ENSMUSP00000094894
Gene: ENSMUSG00000052105

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
low complexity region 54 98 N/A INTRINSIC
low complexity region 99 120 N/A INTRINSIC
low complexity region 127 132 N/A INTRINSIC
low complexity region 166 183 N/A INTRINSIC
low complexity region 240 259 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
SCOP:d1fxkc_ 332 466 3e-7 SMART
Blast:BRLZ 339 362 1e-5 BLAST
Pfam:DUF3166 492 588 1.8e-43 PFAM
Pfam:DUF3166 621 716 5e-19 PFAM
low complexity region 843 859 N/A INTRINSIC
low complexity region 896 910 N/A INTRINSIC
low complexity region 962 973 N/A INTRINSIC
low complexity region 1049 1062 N/A INTRINSIC
coiled coil region 1120 1159 N/A INTRINSIC
Pfam:DUF4482 1220 1392 3.9e-49 PFAM
low complexity region 1464 1476 N/A INTRINSIC
low complexity region 1672 1681 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145347
SMART Domains Protein: ENSMUSP00000121387
Gene: ENSMUSG00000052105

DomainStartEndE-ValueType
Pfam:DUF3166 43 139 9.1e-44 PFAM
Pfam:DUF3166 172 267 2.5e-19 PFAM
low complexity region 394 410 N/A INTRINSIC
low complexity region 447 461 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
low complexity region 600 613 N/A INTRINSIC
coiled coil region 671 710 N/A INTRINSIC
Pfam:DUF4482 771 910 4.6e-49 PFAM
low complexity region 1015 1027 N/A INTRINSIC
low complexity region 1223 1232 N/A INTRINSIC
low complexity region 1463 1475 N/A INTRINSIC
low complexity region 1482 1494 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177034
AA Change: R668H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135690
Gene: ENSMUSG00000052105
AA Change: R668H

DomainStartEndE-ValueType
Pfam:DUF3166 140 236 1.5e-43 PFAM
Pfam:DUF3166 269 364 4e-19 PFAM
low complexity region 491 507 N/A INTRINSIC
low complexity region 544 558 N/A INTRINSIC
low complexity region 610 621 N/A INTRINSIC
coiled coil region 642 674 N/A INTRINSIC
low complexity region 738 751 N/A INTRINSIC
coiled coil region 809 848 N/A INTRINSIC
Pfam:DUF4482 909 1042 4e-49 PFAM
low complexity region 1161 1173 N/A INTRINSIC
low complexity region 1369 1378 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 98% (56/57)
MGI Phenotype PHENOTYPE: Global or Purkinje cell-specific homozygous knockout affects Purkinje cell axon and dendrite morphology, resulting in abnormal motor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 G A 9: 104,000,288 (GRCm39) E681K possibly damaging Het
Accsl A T 2: 93,688,501 (GRCm39) M411K possibly damaging Het
Amn1 C T 6: 149,086,529 (GRCm39) M44I probably benign Het
Bag4 G A 8: 26,267,507 (GRCm39) R108* probably null Het
Cpa1 C T 6: 30,641,767 (GRCm39) T197M probably damaging Het
Cyb561d2 A G 9: 107,418,218 (GRCm39) V50A probably benign Het
Dact1 A G 12: 71,365,325 (GRCm39) D665G probably damaging Het
Dcaf4 G A 12: 83,588,297 (GRCm39) V499I probably damaging Het
Depdc5 T G 5: 33,058,854 (GRCm39) I274M probably damaging Het
Dnah3 T A 7: 119,570,817 (GRCm39) Q2219L probably benign Het
Ect2 A T 3: 27,170,272 (GRCm39) probably benign Het
Efcab14 C A 4: 115,617,159 (GRCm39) S289R probably benign Het
Fmn2 T C 1: 174,437,140 (GRCm39) L1037P unknown Het
Fsip2 G A 2: 82,819,361 (GRCm39) M5031I probably benign Het
Gm19410 A G 8: 36,274,151 (GRCm39) M1435V probably benign Het
Gm8005 G T 14: 42,261,499 (GRCm39) Q44K Het
Hdgfl2 T A 17: 56,406,860 (GRCm39) D591E unknown Het
Hk3 C A 13: 55,159,209 (GRCm39) C449F probably damaging Het
Hmcn1 T C 1: 150,531,586 (GRCm39) M3228V probably benign Het
Kifap3 C T 1: 163,743,337 (GRCm39) R773C probably damaging Het
Kndc1 T C 7: 139,500,612 (GRCm39) V659A probably benign Het
Lhb C T 7: 45,071,101 (GRCm39) R109C probably damaging Het
Lnpep A G 17: 17,798,854 (GRCm39) I267T probably benign Het
Lypla1 T A 1: 4,878,590 (GRCm39) probably null Het
Map3k21 T C 8: 126,654,447 (GRCm39) probably null Het
Mapkbp1 A G 2: 119,844,232 (GRCm39) T319A probably benign Het
Mms19 T C 19: 41,935,455 (GRCm39) T854A probably benign Het
Mphosph8 A G 14: 56,911,495 (GRCm39) T173A probably benign Het
Myo5b G A 18: 74,767,582 (GRCm39) E297K possibly damaging Het
Nrg2 A T 18: 36,157,449 (GRCm39) L412Q probably damaging Het
Nrtn T C 17: 57,058,473 (GRCm39) D176G probably damaging Het
Nrxn1 G T 17: 90,670,334 (GRCm39) Q1134K possibly damaging Het
Oog4 CAA CA 4: 143,164,022 (GRCm39) probably null Het
Or51t4 C T 7: 102,598,473 (GRCm39) P267L probably damaging Het
Pick1 T C 15: 79,139,781 (GRCm39) V360A unknown Het
Pigr T A 1: 130,769,403 (GRCm39) N71K possibly damaging Het
Ppox T C 1: 171,107,765 (GRCm39) N96S probably benign Het
Pramel29 C A 4: 143,939,525 (GRCm39) C4F probably damaging Het
Qrfprl G T 6: 65,429,891 (GRCm39) E196* probably null Het
Rasa1 T C 13: 85,376,827 (GRCm39) T603A probably benign Het
Rhd T C 4: 134,603,770 (GRCm39) L97P probably damaging Het
Sec61a2 T C 2: 5,887,415 (GRCm39) I147V probably benign Het
Sh3bp1 C T 15: 78,795,760 (GRCm39) P630S probably damaging Het
Sh3d21 T C 4: 126,044,937 (GRCm39) T581A probably benign Het
Slc36a2 A G 11: 55,053,498 (GRCm39) I380T probably benign Het
Slc36a4 T A 9: 15,638,108 (GRCm39) V178D probably damaging Het
Smad7 C A 18: 75,526,906 (GRCm39) L251I probably benign Het
Sspo G A 6: 48,426,434 (GRCm39) S151N probably benign Het
St3gal4 C T 9: 34,963,549 (GRCm39) R253Q probably benign Het
Trappc14 C A 5: 138,261,104 (GRCm39) probably null Het
Ttbk1 T C 17: 46,787,857 (GRCm39) I242V possibly damaging Het
Ttn G A 2: 76,798,864 (GRCm39) A470V unknown Het
Unc13b T C 4: 43,091,258 (GRCm39) V28A probably damaging Het
Vmn1r149 A G 7: 22,137,530 (GRCm39) V42A possibly damaging Het
Zbtb21 A T 16: 97,752,740 (GRCm39) C514* probably null Het
Zfp236 A T 18: 82,662,366 (GRCm39) C570* probably null Het
Zfp277 T A 12: 40,379,594 (GRCm39) R313S probably damaging Het
Zfp329 A T 7: 12,544,967 (GRCm39) C186S probably damaging Het
Zscan4-ps2 A G 7: 11,248,954 (GRCm39) probably benign Het
Other mutations in Mtcl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Mtcl1 APN 17 66,651,314 (GRCm39) missense probably benign 0.00
IGL01774:Mtcl1 APN 17 66,692,880 (GRCm39) missense probably damaging 1.00
IGL01918:Mtcl1 APN 17 66,675,263 (GRCm39) missense possibly damaging 0.47
IGL02000:Mtcl1 APN 17 66,661,185 (GRCm39) missense probably benign 0.19
IGL02074:Mtcl1 APN 17 66,673,463 (GRCm39) missense possibly damaging 0.68
IGL02338:Mtcl1 APN 17 66,686,965 (GRCm39) missense probably damaging 1.00
IGL02597:Mtcl1 APN 17 66,645,016 (GRCm39) missense probably benign
IGL03034:Mtcl1 APN 17 66,651,193 (GRCm39) missense probably damaging 1.00
IGL03120:Mtcl1 APN 17 66,686,378 (GRCm39) missense probably damaging 0.96
IGL03184:Mtcl1 APN 17 66,661,209 (GRCm39) missense probably benign 0.01
IGL03240:Mtcl1 APN 17 66,645,014 (GRCm39) missense probably damaging 1.00
IGL03294:Mtcl1 APN 17 66,645,014 (GRCm39) missense probably damaging 1.00
IGL03332:Mtcl1 APN 17 66,645,014 (GRCm39) missense probably damaging 1.00
PIT4378001:Mtcl1 UTSW 17 66,745,274 (GRCm39) missense probably damaging 1.00
PIT4520001:Mtcl1 UTSW 17 66,692,907 (GRCm39) missense possibly damaging 0.48
R0110:Mtcl1 UTSW 17 66,665,109 (GRCm39) missense possibly damaging 0.51
R0113:Mtcl1 UTSW 17 66,661,237 (GRCm39) missense possibly damaging 0.52
R0321:Mtcl1 UTSW 17 66,686,426 (GRCm39) missense probably damaging 1.00
R0366:Mtcl1 UTSW 17 66,645,124 (GRCm39) missense probably damaging 1.00
R0629:Mtcl1 UTSW 17 66,645,137 (GRCm39) missense possibly damaging 0.89
R1466:Mtcl1 UTSW 17 66,687,430 (GRCm39) missense probably damaging 1.00
R1466:Mtcl1 UTSW 17 66,687,430 (GRCm39) missense probably damaging 1.00
R1467:Mtcl1 UTSW 17 66,755,322 (GRCm39) missense probably damaging 1.00
R1467:Mtcl1 UTSW 17 66,755,322 (GRCm39) missense probably damaging 1.00
R1471:Mtcl1 UTSW 17 66,686,143 (GRCm39) missense probably damaging 0.96
R1650:Mtcl1 UTSW 17 66,692,871 (GRCm39) missense probably damaging 1.00
R1754:Mtcl1 UTSW 17 66,687,178 (GRCm39) missense probably damaging 1.00
R1855:Mtcl1 UTSW 17 66,686,509 (GRCm39) missense probably benign
R1882:Mtcl1 UTSW 17 66,686,315 (GRCm39) missense probably benign 0.01
R1935:Mtcl1 UTSW 17 66,686,409 (GRCm39) missense probably benign 0.10
R2063:Mtcl1 UTSW 17 66,653,350 (GRCm39) missense probably damaging 1.00
R2132:Mtcl1 UTSW 17 66,650,618 (GRCm39) missense probably benign 0.04
R2197:Mtcl1 UTSW 17 66,673,427 (GRCm39) missense probably benign
R3196:Mtcl1 UTSW 17 66,650,829 (GRCm39) missense probably benign 0.07
R3877:Mtcl1 UTSW 17 66,649,949 (GRCm39) missense probably damaging 1.00
R4116:Mtcl1 UTSW 17 66,673,476 (GRCm39) missense probably benign
R4204:Mtcl1 UTSW 17 66,745,256 (GRCm39) missense probably damaging 1.00
R4373:Mtcl1 UTSW 17 66,687,074 (GRCm39) missense probably benign 0.05
R4396:Mtcl1 UTSW 17 66,651,220 (GRCm39) missense probably damaging 1.00
R4591:Mtcl1 UTSW 17 66,655,506 (GRCm39) missense probably benign 0.07
R4610:Mtcl1 UTSW 17 66,684,882 (GRCm39) missense probably benign 0.04
R4681:Mtcl1 UTSW 17 66,756,139 (GRCm39) missense unknown
R4922:Mtcl1 UTSW 17 66,655,474 (GRCm39) missense probably benign 0.29
R4992:Mtcl1 UTSW 17 66,649,834 (GRCm39) missense probably damaging 0.99
R5169:Mtcl1 UTSW 17 66,650,818 (GRCm39) missense probably benign 0.00
R5542:Mtcl1 UTSW 17 66,691,354 (GRCm39) intron probably benign
R5804:Mtcl1 UTSW 17 66,650,132 (GRCm39) missense probably benign 0.03
R5998:Mtcl1 UTSW 17 66,675,275 (GRCm39) missense probably damaging 0.99
R6163:Mtcl1 UTSW 17 66,686,326 (GRCm39) missense probably benign 0.10
R6191:Mtcl1 UTSW 17 66,650,521 (GRCm39) missense probably damaging 1.00
R6254:Mtcl1 UTSW 17 66,665,129 (GRCm39) missense probably benign 0.02
R6260:Mtcl1 UTSW 17 66,650,536 (GRCm39) missense probably damaging 1.00
R6524:Mtcl1 UTSW 17 66,655,280 (GRCm39) missense probably benign 0.15
R6884:Mtcl1 UTSW 17 66,745,197 (GRCm39) missense probably damaging 1.00
R7199:Mtcl1 UTSW 17 66,647,534 (GRCm39) missense probably benign 0.13
R7431:Mtcl1 UTSW 17 66,649,901 (GRCm39) nonsense probably null
R7479:Mtcl1 UTSW 17 66,686,485 (GRCm39) missense probably benign
R7608:Mtcl1 UTSW 17 66,650,300 (GRCm39) missense probably damaging 0.96
R7691:Mtcl1 UTSW 17 66,687,352 (GRCm39) missense probably damaging 1.00
R7847:Mtcl1 UTSW 17 66,651,328 (GRCm39) missense probably damaging 0.96
R7908:Mtcl1 UTSW 17 66,678,325 (GRCm39) missense possibly damaging 0.80
R8262:Mtcl1 UTSW 17 66,650,653 (GRCm39) missense probably damaging 0.99
R8324:Mtcl1 UTSW 17 66,743,212 (GRCm39) missense probably damaging 1.00
R8477:Mtcl1 UTSW 17 66,684,942 (GRCm39) missense probably benign 0.10
R8927:Mtcl1 UTSW 17 66,755,628 (GRCm39) missense probably benign 0.00
R8928:Mtcl1 UTSW 17 66,755,628 (GRCm39) missense probably benign 0.00
R9016:Mtcl1 UTSW 17 66,651,062 (GRCm39) missense probably damaging 1.00
R9048:Mtcl1 UTSW 17 66,678,331 (GRCm39) missense probably benign 0.01
R9059:Mtcl1 UTSW 17 66,650,606 (GRCm39) missense probably benign 0.04
R9221:Mtcl1 UTSW 17 66,650,879 (GRCm39) missense probably benign 0.00
R9327:Mtcl1 UTSW 17 66,645,130 (GRCm39) missense probably damaging 0.96
R9398:Mtcl1 UTSW 17 66,755,462 (GRCm39) missense possibly damaging 0.46
R9762:Mtcl1 UTSW 17 66,673,347 (GRCm39) missense probably benign 0.00
X0065:Mtcl1 UTSW 17 66,686,602 (GRCm39) missense probably damaging 1.00
Z1088:Mtcl1 UTSW 17 66,650,723 (GRCm39) missense probably benign 0.20
Z1176:Mtcl1 UTSW 17 66,686,455 (GRCm39) missense probably benign 0.01
Z1177:Mtcl1 UTSW 17 66,651,290 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGGTGGACAGGTTCTCTCTG -3'
(R):5'- TGTCACCTTGTCCAGATGTGTG -3'

Sequencing Primer
(F):5'- CTGGTGCATCTAAGAGTGAGCCTC -3'
(R):5'- CAGATGTGTGTCCTGCGTCATC -3'
Posted On 2019-10-17