Incidental Mutation 'R7597:Slc2a6'
ID587762
Institutional Source Beutler Lab
Gene Symbol Slc2a6
Ensembl Gene ENSMUSG00000036067
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 6
SynonymsF630103L12Rik, Glut6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R7597 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location27021363-27027998 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 27027183 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 70 (D70E)
Ref Sequence ENSEMBL: ENSMUSP00000049103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045702] [ENSMUST00000102890] [ENSMUST00000153388]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045702
AA Change: D70E

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049103
Gene: ENSMUSG00000036067
AA Change: D70E

DomainStartEndE-ValueType
Pfam:MFS_1 37 439 4.1e-25 PFAM
Pfam:Sugar_tr 39 488 8.4e-87 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102890
AA Change: D70E

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099954
Gene: ENSMUSG00000036067
AA Change: D70E

DomainStartEndE-ValueType
Pfam:MFS_1 37 382 5.3e-22 PFAM
Pfam:Sugar_tr 39 341 3.4e-61 PFAM
Pfam:Sugar_tr 337 434 1.8e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000153388
AA Change: D65E

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122054
Gene: ENSMUSG00000036067
AA Change: D65E

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hexose transport into mammalian cells is catalyzed by a family of membrane proteins, including SLC2A6, that contain 12 transmembrane domains and a number of critical conserved residues.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A G 3: 108,471,429 V351A possibly damaging Het
Abcc6 A G 7: 45,995,237 L838P probably damaging Het
Adgrl4 T A 3: 151,543,258 F728I probably damaging Het
Asap1 A G 15: 64,312,455 V7A probably benign Het
B230104I21Rik A G 4: 154,349,593 probably benign Het
C4b A T 17: 34,739,675 S562T probably benign Het
Carmil2 A G 8: 105,695,489 Y1130C probably damaging Het
Cit A T 5: 115,886,681 K328* probably null Het
Col18a1 T C 10: 77,113,303 D125G unknown Het
Cxadr T C 16: 78,329,108 V122A probably damaging Het
Cyp2d22 G A 15: 82,375,852 P44S probably damaging Het
Gabrr1 A G 4: 33,148,964 T74A probably benign Het
Gfm2 C A 13: 97,172,578 A597E probably benign Het
Gm5346 T G 8: 43,625,244 N648H probably damaging Het
H2-T22 T C 17: 36,040,516 Y274C probably damaging Het
Has2 C A 15: 56,668,421 W299C probably damaging Het
Hsd17b6 A G 10: 127,991,358 S282P probably benign Het
Itga1 T C 13: 114,974,140 I972V probably benign Het
Itih5 T A 2: 10,249,376 Y813N probably damaging Het
Kctd16 A G 18: 40,530,795 T326A possibly damaging Het
Klhdc1 T C 12: 69,269,868 S342P probably damaging Het
Kmt2a T C 9: 44,831,353 I1682M unknown Het
Lamc1 T C 1: 153,240,454 K994E possibly damaging Het
Lig1 T G 7: 13,296,344 S416A probably benign Het
Lims1 A G 10: 58,412,441 E240G probably damaging Het
Lnpk T C 2: 74,568,972 M76V probably benign Het
Lrrtm4 T A 6: 80,022,445 L280* probably null Het
Mfap3l A T 8: 60,671,281 I186F possibly damaging Het
Mta3 T C 17: 83,775,582 F234L probably benign Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mybpc2 C T 7: 44,509,799 G609D probably damaging Het
Naga A T 15: 82,334,834 D237E probably benign Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nbn G A 4: 15,963,911 S104N probably damaging Het
Nipsnap2 T C 5: 129,739,573 L60P probably damaging Het
Olfr1317 T A 2: 112,142,580 F212I probably benign Het
Olfr904 G A 9: 38,464,506 G155D probably benign Het
Pclo C T 5: 14,677,587 T2153I unknown Het
Pclo A C 5: 14,858,855 K5059T unknown Het
Pdlim2 C A 14: 70,166,196 A256S possibly damaging Het
Pira2 T C 7: 3,842,461 D308G probably damaging Het
Proc G T 18: 32,123,636 A326E probably damaging Het
Rab40b T C 11: 121,357,883 D182G probably benign Het
Rai14 A G 15: 10,574,851 S703P possibly damaging Het
Rdx C T 9: 52,060,896 P2L possibly damaging Het
Recql5 T C 11: 115,928,381 K120E probably benign Het
Rev3l C T 10: 39,822,884 R1126C probably damaging Het
Slc6a17 A T 3: 107,471,352 D671E possibly damaging Het
Slc7a8 G A 14: 54,781,400 probably benign Het
Srpk2 A G 5: 23,548,519 Y79H possibly damaging Het
Traf3ip1 T A 1: 91,511,445 I361K probably damaging Het
Trpm8 A G 1: 88,328,196 Y191C probably damaging Het
Ubr3 T C 2: 69,973,468 V1135A possibly damaging Het
Usp12 C A 5: 146,754,369 probably null Het
Vmn1r44 C A 6: 89,893,836 P188Q probably benign Het
Xirp2 T A 2: 67,525,755 V3620D possibly damaging Het
Zcchc14 A T 8: 121,608,500 S294T unknown Het
Zfp800 T C 6: 28,260,765 D5G probably damaging Het
Zfp87 C T 13: 67,517,293 R350Q probably benign Het
Other mutations in Slc2a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01788:Slc2a6 APN 2 27024215 nonsense probably null
IGL02892:Slc2a6 APN 2 27024293 missense probably benign 0.08
English UTSW 2 27023131 nonsense probably null
R6368:Slc2a6 UTSW 2 27024587 missense possibly damaging 0.69
R6501:Slc2a6 UTSW 2 27023131 nonsense probably null
R6902:Slc2a6 UTSW 2 27023160 missense probably benign 0.01
R6944:Slc2a6 UTSW 2 27026064 missense probably damaging 1.00
R6993:Slc2a6 UTSW 2 27027243 missense probably damaging 1.00
R6999:Slc2a6 UTSW 2 27026035 frame shift probably null
R7629:Slc2a6 UTSW 2 27024202 missense probably benign 0.00
Z1088:Slc2a6 UTSW 2 27021987 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGGGAGAGATACCGGTGCTC -3'
(R):5'- TTATCTGCCGAGCTGGATG -3'

Sequencing Primer
(F):5'- AGATACCGGTGCTCTAGGG -3'
(R):5'- TCTGGGAACTCAGGGTCCATTTAAAG -3'
Posted On2019-10-24