Incidental Mutation 'R7629:Slc2a6'
ID 589527
Institutional Source Beutler Lab
Gene Symbol Slc2a6
Ensembl Gene ENSMUSG00000036067
Gene Name solute carrier family 2 (facilitated glucose transporter), member 6
Synonyms F630103L12Rik, Glut6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock # R7629 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 27021363-27027998 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 27024202 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 301 (D301G)
Ref Sequence ENSEMBL: ENSMUSP00000049103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045702] [ENSMUST00000102890] [ENSMUST00000114003] [ENSMUST00000114006] [ENSMUST00000114007] [ENSMUST00000153388]
AlphaFold Q3UDF0
Predicted Effect probably benign
Transcript: ENSMUST00000045702
AA Change: D301G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000049103
Gene: ENSMUSG00000036067
AA Change: D301G

DomainStartEndE-ValueType
Pfam:MFS_1 37 439 4.1e-25 PFAM
Pfam:Sugar_tr 39 488 8.4e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102890
AA Change: D301G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000099954
Gene: ENSMUSG00000036067
AA Change: D301G

DomainStartEndE-ValueType
Pfam:MFS_1 37 382 5.3e-22 PFAM
Pfam:Sugar_tr 39 341 3.4e-61 PFAM
Pfam:Sugar_tr 337 434 1.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114003
SMART Domains Protein: ENSMUSP00000109636
Gene: ENSMUSG00000015488

DomainStartEndE-ValueType
Cg6151-P 1 80 6.19e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114006
SMART Domains Protein: ENSMUSP00000109639
Gene: ENSMUSG00000015488

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Cg6151-P 33 142 2.87e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114007
SMART Domains Protein: ENSMUSP00000109640
Gene: ENSMUSG00000015488

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Cg6151-P 33 142 2.87e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153388
SMART Domains Protein: ENSMUSP00000122054
Gene: ENSMUSG00000036067

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hexose transport into mammalian cells is catalyzed by a family of membrane proteins, including SLC2A6, that contain 12 transmembrane domains and a number of critical conserved residues.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik G A 16: 88,707,405 T168I probably benign Het
2410089E03Rik C T 15: 8,227,067 Q2004* probably null Het
Abtb2 T A 2: 103,683,493 probably null Het
Ankrd10 A T 8: 11,615,769 V277E probably benign Het
Ankrd28 C T 14: 31,715,264 V615I probably benign Het
Aqr G A 2: 114,114,593 P1079L probably damaging Het
Brox G A 1: 183,292,504 A60V probably damaging Het
Copg1 T C 6: 87,894,169 V289A possibly damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
D430042O09Rik T C 7: 125,795,250 L192P probably damaging Het
Dido1 T C 2: 180,661,473 N1546S probably benign Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dmxl1 T A 18: 49,859,270 I361N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fhod3 T A 18: 24,754,317 D88E probably benign Het
Flywch1 A G 17: 23,755,770 M632T probably benign Het
Henmt1 A G 3: 108,958,597 T213A probably benign Het
Itga9 T C 9: 118,698,446 V555A probably benign Het
Kif13b C T 14: 64,779,335 R1317* probably null Het
Kndc1 A T 7: 139,895,260 E25V probably damaging Het
Lingo2 T A 4: 35,708,675 D435V possibly damaging Het
Lrrc14b T A 13: 74,361,164 M375L probably benign Het
Lrrtm2 T C 18: 35,214,257 probably null Het
Mgat4c G A 10: 102,389,070 V382I probably benign Het
Mpp6 T C 6: 50,196,623 I489T probably benign Het
Muc16 T C 9: 18,566,785 T7075A possibly damaging Het
Myo5b T A 18: 74,627,254 probably null Het
Neb T C 2: 52,273,961 D1995G possibly damaging Het
Nudt9 T C 5: 104,050,694 V75A possibly damaging Het
Olfr1277 C T 2: 111,269,876 V164I probably benign Het
Paf1 T C 7: 28,395,068 Y35H probably damaging Het
Panx3 T A 9: 37,661,444 Q270L possibly damaging Het
Pde6h G T 6: 136,959,319 R20L possibly damaging Het
Pdxk A G 10: 78,445,006 I200T probably benign Het
Ppara A T 15: 85,798,191 M363L probably damaging Het
Prmt8 A T 6: 127,689,883 L376* probably null Het
Serpina1a G C 12: 103,853,808 T393R probably damaging Het
Sfxn1 C T 13: 54,093,022 R178C probably damaging Het
Sirpb1c A T 3: 15,848,395 W7R possibly damaging Het
Skint5 T C 4: 113,942,660 Y104C probably damaging Het
Slamf6 A T 1: 171,936,624 T195S probably damaging Het
Stab2 A T 10: 86,883,782 probably null Het
Tctn3 C G 19: 40,611,336 D141H probably damaging Het
Tnik A G 3: 28,661,728 N1164D probably damaging Het
Tpcn1 C T 5: 120,537,937 V711I probably benign Het
Trim11 G A 11: 58,978,334 G32D probably damaging Het
Usp32 TTTGGTTG TTTG 11: 85,019,855 probably null Het
Vmn1r72 T C 7: 11,669,784 I246V probably benign Het
Zfp362 G T 4: 128,786,055 R273S probably damaging Het
Zfp715 T C 7: 43,301,676 D66G possibly damaging Het
Other mutations in Slc2a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01788:Slc2a6 APN 2 27024215 nonsense probably null
IGL02892:Slc2a6 APN 2 27024293 missense probably benign 0.08
English UTSW 2 27023131 nonsense probably null
R6368:Slc2a6 UTSW 2 27024587 missense possibly damaging 0.69
R6501:Slc2a6 UTSW 2 27023131 nonsense probably null
R6902:Slc2a6 UTSW 2 27023160 missense probably benign 0.01
R6944:Slc2a6 UTSW 2 27026064 missense probably damaging 1.00
R6993:Slc2a6 UTSW 2 27027243 missense probably damaging 1.00
R6999:Slc2a6 UTSW 2 27026035 frame shift probably null
R7597:Slc2a6 UTSW 2 27027183 missense possibly damaging 0.91
R8195:Slc2a6 UTSW 2 27027826 missense probably benign
R8469:Slc2a6 UTSW 2 27024335 missense probably benign 0.05
R9139:Slc2a6 UTSW 2 27024322 missense possibly damaging 0.93
Z1088:Slc2a6 UTSW 2 27021987 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACTGTCCCAAGAGTTATATATCC -3'
(R):5'- TCACAAGTGCCAAGACAGGG -3'

Sequencing Primer
(F):5'- ACATTGTTTTCTTCTGTTCTTCTGC -3'
(R):5'- CCAAGACAGGGTGGCCAG -3'
Posted On 2019-10-24