Incidental Mutation 'R7597:Pira2'
ID587782
Institutional Source Beutler Lab
Gene Symbol Pira2
Ensembl Gene ENSMUSG00000089942
Gene Namepaired-Ig-like receptor A2
Synonyms6M23
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R7597 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location3836812-3845051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3842461 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 308 (D308G)
Ref Sequence ENSEMBL: ENSMUSP00000104255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108615] [ENSMUST00000119469]
Predicted Effect probably damaging
Transcript: ENSMUST00000108615
AA Change: D308G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104255
Gene: ENSMUSG00000089942
AA Change: D308G

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG 34 118 2.39e-1 SMART
IG_like 129 220 1.94e1 SMART
IG 231 315 7.77e-1 SMART
IG 328 415 3.36e0 SMART
IG_like 435 502 3.18e0 SMART
IG 529 618 8.59e-3 SMART
low complexity region 654 663 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119469
AA Change: D308G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113857
Gene: ENSMUSG00000089942
AA Change: D308G

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG 34 118 2.39e-1 SMART
IG_like 129 220 1.94e1 SMART
IG 231 315 7.77e-1 SMART
IG 328 415 3.36e0 SMART
IG_like 435 502 3.18e0 SMART
IG 529 618 8.59e-3 SMART
low complexity region 637 646 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A G 3: 108,471,429 V351A possibly damaging Het
Abcc6 A G 7: 45,995,237 L838P probably damaging Het
Adgrl4 T A 3: 151,543,258 F728I probably damaging Het
Asap1 A G 15: 64,312,455 V7A probably benign Het
B230104I21Rik A G 4: 154,349,593 probably benign Het
C4b A T 17: 34,739,675 S562T probably benign Het
Carmil2 A G 8: 105,695,489 Y1130C probably damaging Het
Cit A T 5: 115,886,681 K328* probably null Het
Col18a1 T C 10: 77,113,303 D125G unknown Het
Cxadr T C 16: 78,329,108 V122A probably damaging Het
Cyp2d22 G A 15: 82,375,852 P44S probably damaging Het
Gabrr1 A G 4: 33,148,964 T74A probably benign Het
Gfm2 C A 13: 97,172,578 A597E probably benign Het
Gm5346 T G 8: 43,625,244 N648H probably damaging Het
H2-T22 T C 17: 36,040,516 Y274C probably damaging Het
Has2 C A 15: 56,668,421 W299C probably damaging Het
Hsd17b6 A G 10: 127,991,358 S282P probably benign Het
Itga1 T C 13: 114,974,140 I972V probably benign Het
Itih5 T A 2: 10,249,376 Y813N probably damaging Het
Kctd16 A G 18: 40,530,795 T326A possibly damaging Het
Klhdc1 T C 12: 69,269,868 S342P probably damaging Het
Kmt2a T C 9: 44,831,353 I1682M unknown Het
Lamc1 T C 1: 153,240,454 K994E possibly damaging Het
Lig1 T G 7: 13,296,344 S416A probably benign Het
Lims1 A G 10: 58,412,441 E240G probably damaging Het
Lnpk T C 2: 74,568,972 M76V probably benign Het
Lrrtm4 T A 6: 80,022,445 L280* probably null Het
Mfap3l A T 8: 60,671,281 I186F possibly damaging Het
Mta3 T C 17: 83,775,582 F234L probably benign Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mybpc2 C T 7: 44,509,799 G609D probably damaging Het
Naga A T 15: 82,334,834 D237E probably benign Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nbn G A 4: 15,963,911 S104N probably damaging Het
Nipsnap2 T C 5: 129,739,573 L60P probably damaging Het
Olfr1317 T A 2: 112,142,580 F212I probably benign Het
Olfr904 G A 9: 38,464,506 G155D probably benign Het
Pclo C T 5: 14,677,587 T2153I unknown Het
Pclo A C 5: 14,858,855 K5059T unknown Het
Pdlim2 C A 14: 70,166,196 A256S possibly damaging Het
Proc G T 18: 32,123,636 A326E probably damaging Het
Rab40b T C 11: 121,357,883 D182G probably benign Het
Rai14 A G 15: 10,574,851 S703P possibly damaging Het
Rdx C T 9: 52,060,896 P2L possibly damaging Het
Recql5 T C 11: 115,928,381 K120E probably benign Het
Rev3l C T 10: 39,822,884 R1126C probably damaging Het
Slc2a6 G T 2: 27,027,183 D70E possibly damaging Het
Slc6a17 A T 3: 107,471,352 D671E possibly damaging Het
Slc7a8 G A 14: 54,781,400 probably benign Het
Srpk2 A G 5: 23,548,519 Y79H possibly damaging Het
Traf3ip1 T A 1: 91,511,445 I361K probably damaging Het
Trpm8 A G 1: 88,328,196 Y191C probably damaging Het
Ubr3 T C 2: 69,973,468 V1135A possibly damaging Het
Usp12 C A 5: 146,754,369 probably null Het
Vmn1r44 C A 6: 89,893,836 P188Q probably benign Het
Xirp2 T A 2: 67,525,755 V3620D possibly damaging Het
Zcchc14 A T 8: 121,608,500 S294T unknown Het
Zfp800 T C 6: 28,260,765 D5G probably damaging Het
Zfp87 C T 13: 67,517,293 R350Q probably benign Het
Other mutations in Pira2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Pira2 APN 7 3844139 missense probably damaging 1.00
IGL01810:Pira2 APN 7 3844612 missense probably damaging 1.00
IGL03167:Pira2 APN 7 3840920 missense probably damaging 0.98
IGL03171:Pira2 APN 7 3842605 missense probably damaging 1.00
PIT4260001:Pira2 UTSW 7 3842170 missense probably benign
PIT4260001:Pira2 UTSW 7 3842173 missense probably benign
PIT4260001:Pira2 UTSW 7 3842174 missense probably benign
R0517:Pira2 UTSW 7 3844197 splice site probably benign
R1565:Pira2 UTSW 7 3844549 missense probably damaging 1.00
R1870:Pira2 UTSW 7 3844453 missense probably damaging 1.00
R2143:Pira2 UTSW 7 3844345 missense probably damaging 1.00
R2144:Pira2 UTSW 7 3844345 missense probably damaging 1.00
R2145:Pira2 UTSW 7 3844345 missense probably damaging 1.00
R2149:Pira2 UTSW 7 3844171 missense probably damaging 1.00
R2171:Pira2 UTSW 7 3844418 missense probably benign 0.08
R3118:Pira2 UTSW 7 3841677 nonsense probably null
R4658:Pira2 UTSW 7 3840934 missense probably damaging 1.00
R5148:Pira2 UTSW 7 3844593 missense possibly damaging 0.62
R5228:Pira2 UTSW 7 3844374 missense probably benign 0.33
R5583:Pira2 UTSW 7 3842546 missense probably benign 0.34
R5974:Pira2 UTSW 7 3841577 missense probably benign 0.27
R6120:Pira2 UTSW 7 3841554 missense probably damaging 1.00
R6122:Pira2 UTSW 7 3842446 missense probably damaging 1.00
R6392:Pira2 UTSW 7 3843902 missense possibly damaging 0.72
R6658:Pira2 UTSW 7 3842301 missense probably benign 0.00
R6790:Pira2 UTSW 7 3842443 missense probably damaging 1.00
R6990:Pira2 UTSW 7 3841068 missense probably damaging 0.99
R7336:Pira2 UTSW 7 3844345 missense probably damaging 1.00
R7768:Pira2 UTSW 7 3841697 missense not run
R7777:Pira2 UTSW 7 3841697 missense not run
R7861:Pira2 UTSW 7 3844544 missense probably damaging 1.00
R7944:Pira2 UTSW 7 3844544 missense probably damaging 1.00
R8019:Pira2 UTSW 7 3841697 missense not run
Predicted Primers PCR Primer
(F):5'- ACTGACAGCCTGGGTTCATAG -3'
(R):5'- TCTGTGATCACCTCCAAAAGAG -3'

Sequencing Primer
(F):5'- ACTGACAGCCTGGGTTCATAGTATTC -3'
(R):5'- CATCTGGTGTCAGGGGAAC -3'
Posted On2019-10-24