Incidental Mutation 'R7624:Gfra1'
ID589362
Institutional Source Beutler Lab
Gene Symbol Gfra1
Ensembl Gene ENSMUSG00000025089
Gene Nameglial cell line derived neurotrophic factor family receptor alpha 1
SynonymsGDNFR-alpha, GFR alpha-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7624 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location58235604-58455909 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58238446 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 451 (M451K)
Ref Sequence ENSEMBL: ENSMUSP00000026076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026076] [ENSMUST00000129100] [ENSMUST00000140141] [ENSMUST00000152507] [ENSMUST00000169850]
Predicted Effect probably benign
Transcript: ENSMUST00000026076
AA Change: M451K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026076
Gene: ENSMUSG00000025089
AA Change: M451K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GDNF 29 111 1.96e-13 SMART
GDNF 154 233 6.55e-24 SMART
GDNF 243 337 1.62e-28 SMART
low complexity region 362 370 N/A INTRINSIC
low complexity region 455 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129100
AA Change: M446K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117196
Gene: ENSMUSG00000025089
AA Change: M446K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GDNF 29 111 1.96e-13 SMART
GDNF 149 228 6.55e-24 SMART
GDNF 238 332 1.62e-28 SMART
low complexity region 357 365 N/A INTRINSIC
low complexity region 450 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140141
SMART Domains Protein: ENSMUSP00000123022
Gene: ENSMUSG00000025089

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GDNF 29 111 1.96e-13 SMART
GDNF 154 233 6.55e-24 SMART
GDNF 243 337 1.62e-28 SMART
low complexity region 362 370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152507
AA Change: M451K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120333
Gene: ENSMUSG00000025089
AA Change: M451K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GDNF 29 111 1.96e-13 SMART
GDNF 154 233 6.55e-24 SMART
GDNF 243 337 1.62e-28 SMART
low complexity region 362 370 N/A INTRINSIC
low complexity region 455 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169850
AA Change: M451K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130128
Gene: ENSMUSG00000025089
AA Change: M451K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GDNF 29 111 1.96e-13 SMART
GDNF 154 233 6.55e-24 SMART
GDNF 243 337 1.62e-28 SMART
low complexity region 362 370 N/A INTRINSIC
low complexity region 455 465 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein that functions as the receptor for glial cell line derived neurotrophic factor (GDNF). The encoded protein undergoes proteolytic processing to generate a glycosylphosphatidylinositol-anchored cell surface coreceptor that forms a complex with the Ret tyrosine kinase in GDNF signaling pathway. Mice lacking the encoded protein exhibit deficits in the kidneys, the enteric nervous system, and spinal motor and sensory neurons similar mice deficient in GDNF or Ret. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for targeted null mutations lack kidneys and enteric neurons resulting in neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atm C A 9: 53,454,768 R2533L probably damaging Het
Caprin1 T A 2: 103,772,677 M514L possibly damaging Het
Ccdc78 A G 17: 25,787,152 E98G probably damaging Het
Cmya5 A T 13: 93,090,357 M2741K possibly damaging Het
Cnot1 T G 8: 95,751,819 R959S probably damaging Het
Col12a1 G T 9: 79,645,794 probably null Het
Col4a3 A G 1: 82,718,884 T177A probably benign Het
Cpa3 T C 3: 20,225,143 N211D possibly damaging Het
Cryba1 T C 11: 77,722,717 Y36C probably damaging Het
Ctnna1 T A 18: 35,244,844 I632N probably benign Het
D630045J12Rik T C 6: 38,149,563 N1504S probably damaging Het
Dgkz C A 2: 91,942,674 R346L probably damaging Het
Dnajc21 A T 15: 10,461,234 I210N probably damaging Het
Dnajc21 G A 15: 10,461,232 R211C probably benign Het
Dscam T C 16: 96,610,324 D1784G probably damaging Het
Eya3 A G 4: 132,672,951 T94A probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat3 T C 9: 15,959,869 D3742G possibly damaging Het
Ficd T C 5: 113,738,690 F309L probably benign Het
Gm43517 T A 12: 49,391,178 L318Q Het
Gsc A T 12: 104,473,051 V22E possibly damaging Het
Il4ra T C 7: 125,569,108 Y100H probably damaging Het
Ilf3 T C 9: 21,398,044 S486P probably benign Het
Itga10 T A 3: 96,652,953 H594Q probably benign Het
Kcnf1 T C 12: 17,176,136 D28G probably benign Het
Kiss1 A G 1: 133,329,422 K53R possibly damaging Het
Lcn5 A G 2: 25,661,414 I182V probably benign Het
Lcorl T C 5: 45,701,965 D269G probably benign Het
Letm2 A T 8: 25,592,537 C174* probably null Het
Met T G 6: 17,558,835 V1154G probably damaging Het
Mindy3 A G 2: 12,419,189 S22P probably benign Het
Mroh2b G A 15: 4,917,131 R471Q probably damaging Het
Nfe2l3 T C 6: 51,458,272 L604P probably damaging Het
Olfr1044 A T 2: 86,171,220 I199N possibly damaging Het
Olfr1145 A G 2: 87,810,339 Q173R probably damaging Het
Olfr186 T A 16: 59,027,019 Q296L possibly damaging Het
Olfr294 A G 7: 86,616,561 F28S possibly damaging Het
Olfr824 A C 10: 130,126,586 I157S probably damaging Het
Olfr918 C T 9: 38,672,623 V274I probably benign Het
Pcdha9 T A 18: 36,999,796 Y639* probably null Het
Pom121l2 A T 13: 21,983,529 I657L probably damaging Het
Prr14l T A 5: 32,829,623 T843S possibly damaging Het
Rln1 A T 19: 29,332,099 N93K probably damaging Het
Rpl3l A T 17: 24,732,427 M101L probably benign Het
Rtkn A G 6: 83,152,177 Y551C probably benign Het
Rundc1 G C 11: 101,433,479 R337P possibly damaging Het
Scarf1 T A 11: 75,514,416 probably null Het
Serpinb1b T A 13: 33,091,639 probably null Het
Sgsm1 A T 5: 113,274,335 C484* probably null Het
Slc22a19 T A 19: 7,673,303 K547* probably null Het
Slc22a19 T C 19: 7,693,818 T177A probably benign Het
Slc6a5 A C 7: 49,941,866 K526N probably benign Het
Sqle G A 15: 59,330,754 R519Q probably benign Het
Stard9 T C 2: 120,688,146 I517T probably benign Het
Taf15 A T 11: 83,505,023 D518V unknown Het
Tdgf1 C T 9: 110,945,949 probably benign Het
Tenm4 A G 7: 96,895,985 M2440V possibly damaging Het
Tm6sf1 A G 7: 81,868,710 M122V possibly damaging Het
Tmprss9 T A 10: 80,892,219 S548T possibly damaging Het
Trim62 A T 4: 128,883,678 probably benign Het
Ugt2b34 C T 5: 86,891,282 V507M possibly damaging Het
Usp16 T A 16: 87,476,805 M423K probably benign Het
Vmn1r199 T A 13: 22,382,736 S67T probably benign Het
Vmn1r62 A T 7: 5,675,601 M94L probably benign Het
Wnk4 G T 11: 101,264,354 E364* probably null Het
Xpo1 T A 11: 23,282,584 I368N probably damaging Het
Zfp366 A G 13: 99,246,296 T656A probably benign Het
Zfp934 T C 13: 62,518,524 M113V probably benign Het
Zkscan2 A G 7: 123,498,771 V134A probably damaging Het
Other mutations in Gfra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Gfra1 APN 19 58263905 splice site probably benign
IGL01633:Gfra1 APN 19 58267047 missense probably benign 0.41
IGL02675:Gfra1 APN 19 58453355 missense probably damaging 1.00
IGL02676:Gfra1 APN 19 58453355 missense probably damaging 1.00
IGL02677:Gfra1 APN 19 58453355 missense probably damaging 1.00
IGL02723:Gfra1 APN 19 58453251 missense probably benign 0.00
3-1:Gfra1 UTSW 19 58298567 intron probably benign
R0245:Gfra1 UTSW 19 58300554 missense possibly damaging 0.72
R0652:Gfra1 UTSW 19 58300554 missense possibly damaging 0.72
R0697:Gfra1 UTSW 19 58270123 missense probably benign
R0699:Gfra1 UTSW 19 58270123 missense probably benign
R1344:Gfra1 UTSW 19 58238417 missense possibly damaging 0.88
R1418:Gfra1 UTSW 19 58238417 missense possibly damaging 0.88
R1468:Gfra1 UTSW 19 58451975 missense probably benign 0.00
R1468:Gfra1 UTSW 19 58451975 missense probably benign 0.00
R2001:Gfra1 UTSW 19 58300275 missense probably damaging 1.00
R2866:Gfra1 UTSW 19 58239307 missense possibly damaging 0.93
R3416:Gfra1 UTSW 19 58267112 missense probably damaging 1.00
R4352:Gfra1 UTSW 19 58267024 missense probably benign 0.08
R4564:Gfra1 UTSW 19 58239250 splice site probably null
R4727:Gfra1 UTSW 19 58263954 missense probably damaging 0.96
R4755:Gfra1 UTSW 19 58453244 missense probably damaging 1.00
R4914:Gfra1 UTSW 19 58267090 missense probably damaging 1.00
R4915:Gfra1 UTSW 19 58267090 missense probably damaging 1.00
R4917:Gfra1 UTSW 19 58267090 missense probably damaging 1.00
R5813:Gfra1 UTSW 19 58239255 missense probably benign
R6225:Gfra1 UTSW 19 58238398 missense probably damaging 1.00
R7023:Gfra1 UTSW 19 58454332 missense probably damaging 1.00
R7485:Gfra1 UTSW 19 58300312 missense probably damaging 1.00
R7718:Gfra1 UTSW 19 58453457 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TAGCAGTTCTTCAACAGAAGCC -3'
(R):5'- ACGGGTAAAATCCAACCTGAGG -3'

Sequencing Primer
(F):5'- CAACAAAGGAGTTCCCGCTGG -3'
(R):5'- TCCAACCTGAGGAAGTGGGC -3'
Posted On2019-10-24