Incidental Mutation 'R7624:Caprin1'
ID589303
Institutional Source Beutler Lab
Gene Symbol Caprin1
Ensembl Gene ENSMUSG00000027184
Gene Namecell cycle associated protein 1
Synonymscaprin-1, RNG105, MMGPIP137, Gpiap1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.428) question?
Stock #R7624 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location103762941-103797649 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103772677 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 514 (M514L)
Ref Sequence ENSEMBL: ENSMUSP00000028607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028607] [ENSMUST00000111147] [ENSMUST00000145606]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028607
AA Change: M514L

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028607
Gene: ENSMUSG00000027184
AA Change: M514L

DomainStartEndE-ValueType
low complexity region 2 43 N/A INTRINSIC
coiled coil region 52 93 N/A INTRINSIC
low complexity region 176 186 N/A INTRINSIC
low complexity region 271 280 N/A INTRINSIC
low complexity region 309 322 N/A INTRINSIC
low complexity region 326 335 N/A INTRINSIC
Pfam:Caprin-1_C 365 681 1.4e-173 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111147
AA Change: M514L

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106777
Gene: ENSMUSG00000027184
AA Change: M514L

DomainStartEndE-ValueType
low complexity region 2 43 N/A INTRINSIC
coiled coil region 52 93 N/A INTRINSIC
low complexity region 176 186 N/A INTRINSIC
low complexity region 271 280 N/A INTRINSIC
low complexity region 309 322 N/A INTRINSIC
low complexity region 326 335 N/A INTRINSIC
Pfam:Caprin-1_C 365 680 2.4e-135 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143188
SMART Domains Protein: ENSMUSP00000114423
Gene: ENSMUSG00000027184

DomainStartEndE-ValueType
low complexity region 84 93 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
low complexity region 139 148 N/A INTRINSIC
Pfam:Caprin-1_C 178 254 4.2e-22 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000117733
Gene: ENSMUSG00000027184
AA Change: M35L

DomainStartEndE-ValueType
Pfam:Caprin-1_C 1 202 8.2e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145606
SMART Domains Protein: ENSMUSP00000119327
Gene: ENSMUSG00000027184

DomainStartEndE-ValueType
Pfam:Caprin-1_C 1 33 2.9e-11 PFAM
Pfam:Caprin-1_C 32 82 1.4e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (69/70)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased fetal size, bent posture, cyanosis, respiratory failure, and neonatal lethality with impaired neuronal network development and reduced dendritic localization of sodium potassium ATPase subunit isoform mRNAs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atm C A 9: 53,454,768 R2533L probably damaging Het
Ccdc78 A G 17: 25,787,152 E98G probably damaging Het
Cmya5 A T 13: 93,090,357 M2741K possibly damaging Het
Cnot1 T G 8: 95,751,819 R959S probably damaging Het
Col12a1 G T 9: 79,645,794 probably null Het
Col4a3 A G 1: 82,718,884 T177A probably benign Het
Cpa3 T C 3: 20,225,143 N211D possibly damaging Het
Cryba1 T C 11: 77,722,717 Y36C probably damaging Het
Ctnna1 T A 18: 35,244,844 I632N probably benign Het
D630045J12Rik T C 6: 38,149,563 N1504S probably damaging Het
Dgkz C A 2: 91,942,674 R346L probably damaging Het
Dnajc21 A T 15: 10,461,234 I210N probably damaging Het
Dnajc21 G A 15: 10,461,232 R211C probably benign Het
Dscam T C 16: 96,610,324 D1784G probably damaging Het
Eya3 A G 4: 132,672,951 T94A probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat3 T C 9: 15,959,869 D3742G possibly damaging Het
Ficd T C 5: 113,738,690 F309L probably benign Het
Gfra1 A T 19: 58,238,446 M451K probably benign Het
Gm43517 T A 12: 49,391,178 L318Q Het
Gsc A T 12: 104,473,051 V22E possibly damaging Het
Il4ra T C 7: 125,569,108 Y100H probably damaging Het
Ilf3 T C 9: 21,398,044 S486P probably benign Het
Itga10 T A 3: 96,652,953 H594Q probably benign Het
Kcnf1 T C 12: 17,176,136 D28G probably benign Het
Kiss1 A G 1: 133,329,422 K53R possibly damaging Het
Lcn5 A G 2: 25,661,414 I182V probably benign Het
Lcorl T C 5: 45,701,965 D269G probably benign Het
Letm2 A T 8: 25,592,537 C174* probably null Het
Met T G 6: 17,558,835 V1154G probably damaging Het
Mindy3 A G 2: 12,419,189 S22P probably benign Het
Mroh2b G A 15: 4,917,131 R471Q probably damaging Het
Nfe2l3 T C 6: 51,458,272 L604P probably damaging Het
Olfr1044 A T 2: 86,171,220 I199N possibly damaging Het
Olfr1145 A G 2: 87,810,339 Q173R probably damaging Het
Olfr186 T A 16: 59,027,019 Q296L possibly damaging Het
Olfr294 A G 7: 86,616,561 F28S possibly damaging Het
Olfr824 A C 10: 130,126,586 I157S probably damaging Het
Olfr918 C T 9: 38,672,623 V274I probably benign Het
Pcdha9 T A 18: 36,999,796 Y639* probably null Het
Pom121l2 A T 13: 21,983,529 I657L probably damaging Het
Prr14l T A 5: 32,829,623 T843S possibly damaging Het
Rln1 A T 19: 29,332,099 N93K probably damaging Het
Rpl3l A T 17: 24,732,427 M101L probably benign Het
Rtkn A G 6: 83,152,177 Y551C probably benign Het
Rundc1 G C 11: 101,433,479 R337P possibly damaging Het
Scarf1 T A 11: 75,514,416 probably null Het
Serpinb1b T A 13: 33,091,639 probably null Het
Sgsm1 A T 5: 113,274,335 C484* probably null Het
Slc22a19 T A 19: 7,673,303 K547* probably null Het
Slc22a19 T C 19: 7,693,818 T177A probably benign Het
Slc6a5 A C 7: 49,941,866 K526N probably benign Het
Sqle G A 15: 59,330,754 R519Q probably benign Het
Stard9 T C 2: 120,688,146 I517T probably benign Het
Taf15 A T 11: 83,505,023 D518V unknown Het
Tdgf1 C T 9: 110,945,949 probably benign Het
Tenm4 A G 7: 96,895,985 M2440V possibly damaging Het
Tm6sf1 A G 7: 81,868,710 M122V possibly damaging Het
Tmprss9 T A 10: 80,892,219 S548T possibly damaging Het
Trim62 A T 4: 128,883,678 probably benign Het
Ugt2b34 C T 5: 86,891,282 V507M possibly damaging Het
Usp16 T A 16: 87,476,805 M423K probably benign Het
Vmn1r199 T A 13: 22,382,736 S67T probably benign Het
Vmn1r62 A T 7: 5,675,601 M94L probably benign Het
Wnk4 G T 11: 101,264,354 E364* probably null Het
Xpo1 T A 11: 23,282,584 I368N probably damaging Het
Zfp366 A G 13: 99,246,296 T656A probably benign Het
Zfp934 T C 13: 62,518,524 M113V probably benign Het
Zkscan2 A G 7: 123,498,771 V134A probably damaging Het
Other mutations in Caprin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Caprin1 APN 2 103775456 missense probably benign 0.00
IGL01369:Caprin1 APN 2 103768865 missense probably damaging 0.99
IGL02054:Caprin1 APN 2 103771798 splice site probably null
IGL02260:Caprin1 APN 2 103779369 missense probably damaging 1.00
IGL02526:Caprin1 APN 2 103775603 unclassified probably benign
IGL03405:Caprin1 APN 2 103779505 missense probably damaging 1.00
R0027:Caprin1 UTSW 2 103775580 unclassified probably benign
R0396:Caprin1 UTSW 2 103769569 missense probably damaging 0.99
R0603:Caprin1 UTSW 2 103796801 missense probably benign 0.01
R1406:Caprin1 UTSW 2 103775987 missense probably benign 0.39
R1406:Caprin1 UTSW 2 103775987 missense probably benign 0.39
R1558:Caprin1 UTSW 2 103775987 missense possibly damaging 0.75
R1657:Caprin1 UTSW 2 103769506 missense probably damaging 0.99
R2945:Caprin1 UTSW 2 103772809 missense probably benign 0.04
R3946:Caprin1 UTSW 2 103796766 missense probably damaging 0.99
R5208:Caprin1 UTSW 2 103769433 critical splice donor site probably null
R6108:Caprin1 UTSW 2 103776017 missense possibly damaging 0.93
R6603:Caprin1 UTSW 2 103775511 missense probably benign 0.01
R7247:Caprin1 UTSW 2 103779474 missense possibly damaging 0.63
R7338:Caprin1 UTSW 2 103779423 missense probably benign 0.01
R7749:Caprin1 UTSW 2 103771754 missense probably benign 0.03
R7946:Caprin1 UTSW 2 103772748 missense probably damaging 0.99
R8304:Caprin1 UTSW 2 103769517 missense probably damaging 1.00
R8324:Caprin1 UTSW 2 103783181 nonsense probably null
R8547:Caprin1 UTSW 2 103769517 missense probably damaging 1.00
R8549:Caprin1 UTSW 2 103769517 missense probably damaging 1.00
R8782:Caprin1 UTSW 2 103772788 missense probably benign 0.06
Z1177:Caprin1 UTSW 2 103775934 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GTGCTTAATCCTTCAGGCATTC -3'
(R):5'- AGAAGTAGCGTACCACTAAAGTAC -3'

Sequencing Primer
(F):5'- TTCCACGTGAGTTCCAAGG -3'
(R):5'- GTAGCGTACCACTAAAGTACATTTG -3'
Posted On2019-10-24