Incidental Mutation 'R7637:Tmx3'
ID590037
Institutional Source Beutler Lab
Gene Symbol Tmx3
Ensembl Gene ENSMUSG00000024614
Gene Namethioredoxin-related transmembrane protein 3
Synonyms6430411B10Rik, A730024F05Rik, Txndc10
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.625) question?
Stock #R7637 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location90510154-90543267 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90537109 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 317 (T317A)
Ref Sequence ENSEMBL: ENSMUSP00000025515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025515]
Predicted Effect probably damaging
Transcript: ENSMUST00000025515
AA Change: T317A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025515
Gene: ENSMUSG00000024614
AA Change: T317A

DomainStartEndE-ValueType
Pfam:Thioredoxin 30 132 3.6e-26 PFAM
Pfam:Thioredoxin_6 160 341 1.6e-27 PFAM
transmembrane domain 377 399 N/A INTRINSIC
low complexity region 418 436 N/A INTRINSIC
Meta Mutation Damage Score 0.1000 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, a catalytically active thioredoxin domain, one transmembrane domain and a C-terminal ER-retention sequence. This gene is expressed in many tissues but has its highest expression in heart and skeletal muscle. It is expressed in the retinal neuroepithelium and lens epithelium in the developing murine eye and haploinsufficiency of this gene in humans and zebrafish is associated with microphthalmia. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,218,952 Q651L probably benign Het
Adam8 C T 7: 139,985,430 V624I probably damaging Het
Ccdc144b T A 3: 36,046,876 Q49L probably damaging Het
Cltc T C 11: 86,730,332 H287R probably damaging Het
Cmya5 T C 13: 93,083,212 K3243R possibly damaging Het
Dock5 G A 14: 67,786,340 T1124M possibly damaging Het
Fam8a1 A T 13: 46,671,247 M237L probably benign Het
Fars2 G T 13: 36,204,775 K82N probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm5767 C T 16: 8,683,646 P59L unknown Het
Gnat3 A G 5: 18,003,772 D158G Het
Grhl2 A C 15: 37,328,330 N400T probably damaging Het
Grin2c A T 11: 115,256,259 probably null Het
Hipk4 A G 7: 27,523,548 Y11C probably damaging Het
Hspa9 G T 18: 34,938,687 A620E not run Het
Igkv12-89 A G 6: 68,835,099 S29P probably benign Het
Itga8 A T 2: 12,109,187 D1039E probably damaging Het
Itgae A T 11: 73,113,631 D248V probably damaging Het
Kmt2c T C 5: 25,315,095 K2006E probably damaging Het
Mdga1 C T 17: 29,832,379 G934R probably benign Het
Mov10 T C 3: 104,795,885 N896S probably benign Het
Ndufb6 A T 4: 40,273,080 probably null Het
Nlk T C 11: 78,591,005 probably null Het
Notch2 T A 3: 98,146,623 S2201T probably damaging Het
Olfr152 A T 2: 87,783,434 D298V probably damaging Het
Pank1 A C 19: 34,821,988 probably null Het
Pdlim3 T C 8: 45,909,065 F126S probably damaging Het
Pds5a C A 5: 65,638,604 G648C probably benign Het
Plekhh3 T C 11: 101,164,327 I567V unknown Het
Ppfia2 T C 10: 106,865,403 probably null Het
Prl3d1 A G 13: 27,100,069 D207G probably damaging Het
Prss23 T A 7: 89,510,246 D205V probably benign Het
Pygl C T 12: 70,197,795 probably null Het
Qsox2 A G 2: 26,221,020 F111S probably damaging Het
Sart3 T C 5: 113,771,352 N95S probably benign Het
Scpep1 A G 11: 88,929,220 F414S probably damaging Het
Selenbp1 C A 3: 94,937,348 Y105* probably null Het
Sirpa A G 2: 129,616,445 D327G probably benign Het
Sowahc G A 10: 59,222,183 R47H probably damaging Het
Szt2 T C 4: 118,393,828 Y361C probably damaging Het
Taf3 A G 2: 9,940,993 V600A probably benign Het
Tie1 T C 4: 118,472,978 I1042M probably damaging Het
Tmem132e T A 11: 82,434,516 L114Q probably damaging Het
Tppp3 A G 8: 105,468,292 V69A probably benign Het
Tpr T C 1: 150,423,516 Y1156H probably damaging Het
Trank1 A C 9: 111,365,296 D796A possibly damaging Het
Tsc2 G A 17: 24,607,492 P928S probably benign Het
Unc80 G T 1: 66,672,684 V2722F possibly damaging Het
Vmn1r199 G T 13: 22,382,675 L46F probably benign Het
Vps13a A T 19: 16,750,149 H196Q probably benign Het
Wnt10a T A 1: 74,793,474 C75* probably null Het
Zfp335 A G 2: 164,892,539 probably null Het
Other mutations in Tmx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Tmx3 APN 18 90540054 missense possibly damaging 0.53
IGL01790:Tmx3 APN 18 90511334 critical splice donor site probably null
IGL01888:Tmx3 APN 18 90527921 missense probably benign 0.05
IGL02689:Tmx3 APN 18 90537116 missense possibly damaging 0.70
IGL03212:Tmx3 APN 18 90538518 missense probably damaging 0.98
R0243:Tmx3 UTSW 18 90538489 splice site probably benign
R0255:Tmx3 UTSW 18 90540006 missense probably damaging 0.96
R0981:Tmx3 UTSW 18 90537200 missense probably benign
R1528:Tmx3 UTSW 18 90537086 missense possibly damaging 0.89
R1772:Tmx3 UTSW 18 90532997 missense probably benign
R2144:Tmx3 UTSW 18 90517490 missense probably damaging 1.00
R2155:Tmx3 UTSW 18 90510381 splice site probably null
R2202:Tmx3 UTSW 18 90527913 missense probably damaging 1.00
R2444:Tmx3 UTSW 18 90540183 missense probably damaging 1.00
R2960:Tmx3 UTSW 18 90532992 missense probably damaging 0.98
R3435:Tmx3 UTSW 18 90527904 missense probably damaging 1.00
R3946:Tmx3 UTSW 18 90524335 missense possibly damaging 0.78
R4427:Tmx3 UTSW 18 90523601 missense probably damaging 0.99
R4708:Tmx3 UTSW 18 90521039 critical splice donor site probably null
R5748:Tmx3 UTSW 18 90537101 missense probably benign 0.05
R5938:Tmx3 UTSW 18 90527934 missense possibly damaging 0.79
R6266:Tmx3 UTSW 18 90537210 splice site probably null
R7311:Tmx3 UTSW 18 90540071 missense probably benign 0.13
R7649:Tmx3 UTSW 18 90540030 missense probably damaging 1.00
R7899:Tmx3 UTSW 18 90527874 critical splice acceptor site probably null
R7982:Tmx3 UTSW 18 90527874 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GAAAAGTTCTTGTAGACCACAGTG -3'
(R):5'- TGGGATGAAGCTGATTCCCTC -3'

Sequencing Primer
(F):5'- AGCTCCTAAGATATAAATGAGG -3'
(R):5'- GGGATGAAGCTGATTCCCTCTAACC -3'
Posted On2019-10-24