Incidental Mutation 'R7683:Smad9'
ID592859
Institutional Source Beutler Lab
Gene Symbol Smad9
Ensembl Gene ENSMUSG00000027796
Gene NameSMAD family member 9
SynonymsSMAD8A, MADH6, SMAD8B, Madh9
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7683 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location54755582-54801257 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54789264 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 250 (E250G)
Ref Sequence ENSEMBL: ENSMUSP00000029371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029371]
Predicted Effect probably damaging
Transcript: ENSMUST00000029371
AA Change: E250G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029371
Gene: ENSMUSG00000027796
AA Change: E250G

DomainStartEndE-ValueType
DWA 29 138 3.47e-68 SMART
DWB 234 406 1.02e-106 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a family of proteins that act as downstream effectors of the bone morphogenetic protein (BMP) signaling pathway. The encoded protein is phosphorylated by BMP receptors, which stimulates its binding to SMAD4 and translocation into the nucleus, where it functions as a regulator of transcription. Activity of this protein is important for embryonic development. Mutation of this gene results in defects in pulmonary vasculature. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous mutant mice in which exon 3 was deleted are viable and fertile. Mutant mice in which a neo cassette is inserted in exon 3 resulting in a hypomorphic allele exhibit reduced midbrain and hindbrain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 A G 13: 59,512,498 C305R probably damaging Het
Anpep C A 7: 79,839,198 V381L probably damaging Het
Ap5s1 T C 2: 131,212,707 L146P probably damaging Het
Arhgef11 A G 3: 87,722,383 I599V probably damaging Het
Arpc2 T C 1: 74,263,814 Y250H probably damaging Het
Baz1b T A 5: 135,217,728 M677K probably damaging Het
Begain C T 12: 109,033,487 A453T unknown Het
C1ql4 T C 15: 99,087,211 D173G probably benign Het
Card11 T G 5: 140,896,026 N461T probably benign Het
Ccdc9 T C 7: 16,284,362 D7G probably damaging Het
Ces2a T C 8: 104,737,112 V152A probably benign Het
Chl1 G A 6: 103,691,652 A449T possibly damaging Het
Col11a1 G T 3: 114,113,736 G638W unknown Het
Cse1l A T 2: 166,922,788 T171S probably benign Het
D2hgdh T A 1: 93,838,965 probably null Het
Dlg4 T C 11: 70,039,854 Y432H possibly damaging Het
Dmwd C T 7: 19,080,735 L437F probably damaging Het
F11 T A 8: 45,249,508 Q251L probably damaging Het
Gm13078 A T 4: 143,726,714 K131* probably null Het
Gtf2f1 T A 17: 57,005,458 E195V possibly damaging Het
Hap1 A T 11: 100,351,548 L376Q probably damaging Het
Hars2 T A 18: 36,788,236 I234N probably damaging Het
Hcfc2 T C 10: 82,699,229 V29A probably benign Het
Hp C T 8: 109,579,099 probably benign Het
Hrh1 T C 6: 114,479,787 S10P probably benign Het
Kcnmb2 A G 3: 32,198,316 Y222C probably damaging Het
Kdm3a A G 6: 71,599,454 V792A probably benign Het
Kif13b G A 14: 64,757,507 V903I probably benign Het
Lars2 G T 9: 123,377,830 probably null Het
Med7 A G 11: 46,440,860 D94G possibly damaging Het
Mier3 A G 13: 111,705,312 T136A probably benign Het
Nin T C 12: 70,078,182 E122G Het
Olfr186 G T 16: 59,027,106 T267K probably benign Het
Olfr427 A G 1: 174,099,476 Q6R probably benign Het
Oxsr1 T C 9: 119,241,755 I489V probably benign Het
Pdcd6ip A T 9: 113,687,695 L216Q probably damaging Het
Ppp4r4 T A 12: 103,587,105 C379* probably null Het
Ptpn13 T A 5: 103,565,152 C1714S probably benign Het
Pum2 G A 12: 8,728,922 R498Q possibly damaging Het
Sema3d T A 5: 12,573,856 Y577* probably null Het
Slc29a3 G A 10: 60,716,366 P300S not run Het
Slc5a4b A G 10: 76,064,072 V444A probably damaging Het
Srsf7 A G 17: 80,207,274 probably benign Het
Thsd7b A G 1: 129,595,946 Y239C probably damaging Het
Triml2 C A 8: 43,185,288 Q98K probably damaging Het
Txndc11 A T 16: 11,084,235 L705Q probably damaging Het
Vmn1r22 A G 6: 57,900,419 M191T probably damaging Het
Vmn2r89 A T 14: 51,455,194 K151N probably benign Het
Vwa5a A G 9: 38,734,829 I498V probably damaging Het
Zfp459 T C 13: 67,408,496 H156R probably damaging Het
Zscan18 T A 7: 12,769,605 K676* probably null Het
Other mutations in Smad9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02045:Smad9 APN 3 54786172 missense possibly damaging 0.95
IGL02666:Smad9 APN 3 54782467 missense probably damaging 1.00
IGL03346:Smad9 APN 3 54789215 missense probably benign
R1839:Smad9 UTSW 3 54789179 splice site probably benign
R1888:Smad9 UTSW 3 54789179 splice site probably benign
R3622:Smad9 UTSW 3 54789284 missense probably damaging 0.96
R3623:Smad9 UTSW 3 54789284 missense probably damaging 0.96
R3624:Smad9 UTSW 3 54789284 missense probably damaging 0.96
R3708:Smad9 UTSW 3 54786181 missense probably benign
R4469:Smad9 UTSW 3 54782761 missense probably damaging 1.00
R4756:Smad9 UTSW 3 54794453 missense possibly damaging 0.50
R4938:Smad9 UTSW 3 54789230 missense probably benign 0.00
R5139:Smad9 UTSW 3 54797406 missense possibly damaging 0.94
R5783:Smad9 UTSW 3 54794442 missense probably benign 0.15
R6200:Smad9 UTSW 3 54789186 missense probably benign
R6437:Smad9 UTSW 3 54786084 missense probably benign 0.33
R6478:Smad9 UTSW 3 54782443 missense probably damaging 1.00
R6552:Smad9 UTSW 3 54782746 missense probably damaging 1.00
R7058:Smad9 UTSW 3 54786193 missense probably benign 0.01
R7314:Smad9 UTSW 3 54789323 missense probably benign 0.00
R7492:Smad9 UTSW 3 54786326 splice site probably null
Z1177:Smad9 UTSW 3 54786222 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTCCTACAGTTCTCATTCTGG -3'
(R):5'- ACCACTGTAGCAGGCTTCTTG -3'

Sequencing Primer
(F):5'- GTTTAAAGCGGTCACCTGC -3'
(R):5'- CAGGCTTCTTGGAGCTCAGAAG -3'
Posted On2019-11-12