Incidental Mutation 'R7683:Nin'
ID 592890
Institutional Source Beutler Lab
Gene Symbol Nin
Ensembl Gene ENSMUSG00000021068
Gene Name ninein
Synonyms 3110068G20Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7683 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 70011435-70113717 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70078182 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 122 (E122G)
Ref Sequence ENSEMBL: ENSMUSP00000082422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021468] [ENSMUST00000085314] [ENSMUST00000095666] [ENSMUST00000169074] [ENSMUST00000220689] [ENSMUST00000221275] [ENSMUST00000222237] [ENSMUST00000222835] [ENSMUST00000223257]
AlphaFold Q61043
Predicted Effect probably damaging
Transcript: ENSMUST00000021468
AA Change: E122G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021468
Gene: ENSMUSG00000021068
AA Change: E122G

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000082422
Gene: ENSMUSG00000021068
AA Change: E122G

DomainStartEndE-ValueType
internal_repeat_1 7 67 4.15e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 4.15e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1971 2045 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095666
AA Change: E122G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093327
Gene: ENSMUSG00000021068
AA Change: E122G

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169074
AA Change: E122G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129648
Gene: ENSMUSG00000021068
AA Change: E122G

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000220689
AA Change: E122G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000222835
AA Change: E122G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000223257
AA Change: E122G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the proteins important for centrosomal function. This protein is important for positioning and anchoring the microtubules minus-ends in epithelial cells. Localization of this protein to the centrosome requires three leucine zippers in the central coiled-coil domain. Multiple alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 A G 13: 59,512,498 C305R probably damaging Het
Anpep C A 7: 79,839,198 V381L probably damaging Het
Ap5s1 T C 2: 131,212,707 L146P probably damaging Het
Arhgef11 A G 3: 87,722,383 I599V probably damaging Het
Arpc2 T C 1: 74,263,814 Y250H probably damaging Het
Baz1b T A 5: 135,217,728 M677K probably damaging Het
Begain C T 12: 109,033,487 A453T unknown Het
C1ql4 T C 15: 99,087,211 D173G probably benign Het
Card11 T G 5: 140,896,026 N461T probably benign Het
Ccdc9 T C 7: 16,284,362 D7G probably damaging Het
Ces2a T C 8: 104,737,112 V152A probably benign Het
Chl1 G A 6: 103,691,652 A449T possibly damaging Het
Col11a1 G T 3: 114,113,736 G638W unknown Het
Cse1l A T 2: 166,922,788 T171S probably benign Het
D2hgdh T A 1: 93,838,965 probably null Het
Dlg4 T C 11: 70,039,854 Y432H possibly damaging Het
Dmwd C T 7: 19,080,735 L437F probably damaging Het
F11 T A 8: 45,249,508 Q251L probably damaging Het
Gm13078 A T 4: 143,726,714 K131* probably null Het
Gtf2f1 T A 17: 57,005,458 E195V possibly damaging Het
Hap1 A T 11: 100,351,548 L376Q probably damaging Het
Hars2 T A 18: 36,788,236 I234N probably damaging Het
Hcfc2 T C 10: 82,699,229 V29A probably benign Het
Hp C T 8: 109,579,099 probably benign Het
Hrh1 T C 6: 114,479,787 S10P probably benign Het
Kcnmb2 A G 3: 32,198,316 Y222C probably damaging Het
Kdm3a A G 6: 71,599,454 V792A probably benign Het
Kif13b G A 14: 64,757,507 V903I probably benign Het
Lars2 G T 9: 123,377,830 probably null Het
Med7 A G 11: 46,440,860 D94G possibly damaging Het
Mier3 A G 13: 111,705,312 T136A probably benign Het
Olfr186 G T 16: 59,027,106 T267K probably benign Het
Olfr427 A G 1: 174,099,476 Q6R probably benign Het
Oxsr1 T C 9: 119,241,755 I489V probably benign Het
Pdcd6ip A T 9: 113,687,695 L216Q probably damaging Het
Ppp4r4 T A 12: 103,587,105 C379* probably null Het
Ptpn13 T A 5: 103,565,152 C1714S probably benign Het
Pum2 G A 12: 8,728,922 R498Q possibly damaging Het
Sema3d T A 5: 12,573,856 Y577* probably null Het
Slc29a3 G A 10: 60,716,366 P300S not run Het
Slc5a4b A G 10: 76,064,072 V444A probably damaging Het
Smad9 A G 3: 54,789,264 E250G probably damaging Het
Srsf7 A G 17: 80,207,274 probably benign Het
Thsd7b A G 1: 129,595,946 Y239C probably damaging Het
Triml2 C A 8: 43,185,288 Q98K probably damaging Het
Txndc11 A T 16: 11,084,235 L705Q probably damaging Het
Vmn1r22 A G 6: 57,900,419 M191T probably damaging Het
Vmn2r89 A T 14: 51,455,194 K151N probably benign Het
Vwa5a A G 9: 38,734,829 I498V probably damaging Het
Zfp459 T C 13: 67,408,496 H156R probably damaging Het
Zscan18 T A 7: 12,769,605 K676* probably null Het
Other mutations in Nin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Nin APN 12 70030088 missense probably damaging 0.98
IGL00677:Nin APN 12 70026860 missense probably damaging 1.00
IGL00823:Nin APN 12 70014793 missense probably benign 0.01
IGL01103:Nin APN 12 70056758 missense probably damaging 0.99
IGL01113:Nin APN 12 70031779 missense probably damaging 1.00
IGL01420:Nin APN 12 70045414 missense probably benign 0.08
IGL01556:Nin APN 12 70043188 missense probably benign 0.01
IGL01663:Nin APN 12 70043665 missense possibly damaging 0.72
IGL02002:Nin APN 12 70062699 nonsense probably null
IGL02030:Nin APN 12 70045268 missense probably damaging 1.00
IGL02202:Nin APN 12 70055436 missense probably damaging 1.00
IGL02207:Nin APN 12 70056657 missense probably damaging 0.99
IGL02257:Nin APN 12 70102691 missense possibly damaging 0.71
IGL02394:Nin APN 12 70044031 missense probably damaging 1.00
IGL02531:Nin APN 12 70020932 missense probably benign 0.02
IGL03028:Nin APN 12 70035270 missense probably benign 0.13
IGL03155:Nin APN 12 70031770 missense probably damaging 1.00
IGL03197:Nin APN 12 70026810 missense probably benign 0.03
IGL02835:Nin UTSW 12 70056738 missense probably damaging 1.00
R0131:Nin UTSW 12 70051141 missense probably damaging 1.00
R0131:Nin UTSW 12 70051141 missense probably damaging 1.00
R0132:Nin UTSW 12 70051141 missense probably damaging 1.00
R0211:Nin UTSW 12 70014875 missense probably damaging 1.00
R0211:Nin UTSW 12 70014875 missense probably damaging 1.00
R0734:Nin UTSW 12 70030113 missense probably benign 0.01
R0947:Nin UTSW 12 70061186 missense probably damaging 1.00
R1085:Nin UTSW 12 70020962 missense possibly damaging 0.91
R1367:Nin UTSW 12 70043929 missense probably damaging 0.99
R1452:Nin UTSW 12 70017650 nonsense probably null
R1477:Nin UTSW 12 70044184 missense possibly damaging 0.87
R1518:Nin UTSW 12 70014773 missense probably benign 0.27
R1566:Nin UTSW 12 70054479 missense probably damaging 0.99
R1572:Nin UTSW 12 70038750 missense probably damaging 1.00
R1583:Nin UTSW 12 70031738 missense probably benign
R1584:Nin UTSW 12 70042669 missense probably benign 0.03
R1699:Nin UTSW 12 70030938 missense probably benign 0.40
R1699:Nin UTSW 12 70045563 missense possibly damaging 0.87
R1765:Nin UTSW 12 70042891 missense probably damaging 1.00
R1794:Nin UTSW 12 70043795 nonsense probably null
R1952:Nin UTSW 12 70030926 missense probably damaging 1.00
R2004:Nin UTSW 12 70025477 missense probably benign 0.01
R2025:Nin UTSW 12 70030008 missense probably damaging 1.00
R2060:Nin UTSW 12 70042418 missense possibly damaging 0.64
R2213:Nin UTSW 12 70045354 missense probably damaging 1.00
R2224:Nin UTSW 12 70061230 missense probably damaging 1.00
R2247:Nin UTSW 12 70054545 missense probably damaging 1.00
R2972:Nin UTSW 12 70062713 missense probably damaging 1.00
R3776:Nin UTSW 12 70038682 missense possibly damaging 0.71
R3881:Nin UTSW 12 70042541 missense probably benign 0.00
R3930:Nin UTSW 12 70078242 missense probably damaging 1.00
R3959:Nin UTSW 12 70050752 missense probably damaging 1.00
R4229:Nin UTSW 12 70051210 missense probably damaging 0.99
R4359:Nin UTSW 12 70014938 missense probably benign 0.00
R4423:Nin UTSW 12 70042978 missense probably damaging 1.00
R4461:Nin UTSW 12 70042585 missense probably benign 0.37
R4639:Nin UTSW 12 70038601 missense probably damaging 0.97
R4791:Nin UTSW 12 70043807 missense possibly damaging 0.94
R4839:Nin UTSW 12 70090551 missense possibly damaging 0.46
R4912:Nin UTSW 12 70044063 missense probably damaging 1.00
R5712:Nin UTSW 12 70042769 missense probably damaging 1.00
R5726:Nin UTSW 12 70078179 missense probably damaging 1.00
R5804:Nin UTSW 12 70045601 missense possibly damaging 0.58
R5874:Nin UTSW 12 70030918 missense possibly damaging 0.94
R5992:Nin UTSW 12 70045524 missense possibly damaging 0.83
R6077:Nin UTSW 12 70019232 missense probably damaging 1.00
R6184:Nin UTSW 12 70043737 missense probably damaging 1.00
R6307:Nin UTSW 12 70014857 missense possibly damaging 0.91
R6315:Nin UTSW 12 70045615 missense probably damaging 1.00
R6326:Nin UTSW 12 70045181 missense possibly damaging 0.95
R6492:Nin UTSW 12 70054534 missense probably benign 0.22
R6562:Nin UTSW 12 70055954 missense probably damaging 1.00
R6578:Nin UTSW 12 70061194 missense probably damaging 0.99
R6613:Nin UTSW 12 70030954 missense probably damaging 1.00
R7112:Nin UTSW 12 70102799 missense
R7170:Nin UTSW 12 70044239 missense
R7324:Nin UTSW 12 70043734 missense
R7338:Nin UTSW 12 70044064 missense
R7372:Nin UTSW 12 70056029 missense
R7431:Nin UTSW 12 70078223 missense
R7577:Nin UTSW 12 70062706 missense
R7655:Nin UTSW 12 70042768 missense
R7656:Nin UTSW 12 70042768 missense
R7769:Nin UTSW 12 70043230 missense
R7981:Nin UTSW 12 70042817 missense
R8138:Nin UTSW 12 70042898 missense
R8141:Nin UTSW 12 70030021 missense
R8754:Nin UTSW 12 70031013 intron probably benign
R8790:Nin UTSW 12 70021019 missense
R8899:Nin UTSW 12 70030936 missense probably damaging 1.00
R8974:Nin UTSW 12 70078158 missense
R9085:Nin UTSW 12 70030012 nonsense probably null
R9143:Nin UTSW 12 70090575 missense
R9380:Nin UTSW 12 70028031 missense
R9496:Nin UTSW 12 70055988 missense
R9638:Nin UTSW 12 70020844 missense
R9709:Nin UTSW 12 70102694 missense
R9745:Nin UTSW 12 70043125 missense
R9792:Nin UTSW 12 70047235 missense
Z1176:Nin UTSW 12 70049164 critical splice acceptor site probably null
Z1177:Nin UTSW 12 70044095 missense
Z1177:Nin UTSW 12 70054426 missense
Predicted Primers PCR Primer
(F):5'- ATGCCTAACTTGTGTCTCATGC -3'
(R):5'- TGACCCAAGGACTCATATGCG -3'

Sequencing Primer
(F):5'- TGTGTCTCATGCTACCCAGGG -3'
(R):5'- GGATCCTACAAGAGGCTGTACC -3'
Posted On 2019-11-12