Incidental Mutation 'R7690:Myom2'
ID593339
Institutional Source Beutler Lab
Gene Symbol Myom2
Ensembl Gene ENSMUSG00000031461
Gene Namemyomesin 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R7690 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location15057653-15133541 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 15111717 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000033842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033842]
Predicted Effect probably null
Transcript: ENSMUST00000033842
SMART Domains Protein: ENSMUSP00000033842
Gene: ENSMUSG00000031461

DomainStartEndE-ValueType
low complexity region 34 63 N/A INTRINSIC
low complexity region 79 87 N/A INTRINSIC
coiled coil region 97 129 N/A INTRINSIC
IG 160 247 7.7e-5 SMART
IG 284 373 8.01e-3 SMART
FN3 383 466 1.5e-14 SMART
FN3 511 594 1.79e-12 SMART
FN3 612 693 1.95e-13 SMART
FN3 711 794 8.69e-11 SMART
FN3 813 896 1.86e-10 SMART
IG_like 913 999 1.58e2 SMART
Blast:IG_like 1021 1106 1e-44 BLAST
IG_like 1135 1215 2.27e1 SMART
Blast:IG_like 1227 1321 9e-51 BLAST
IGc2 1357 1425 4.96e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD and 165 kD. The predicted MYOM2 protein contains 1,465 amino acids. Like MYOM1, MYOM2 has a unique N-terminal domain followed by 12 repeat domains with strong homology to either fibronectin type III or immunoglobulin C2 domains. Protein sequence comparisons suggested that the MYOM2 protein and bovine M protein are identical. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,314,154 T710S probably benign Het
Adgrl2 A G 3: 148,817,298 L430P Het
Agap1 T C 1: 89,843,071 S648P probably benign Het
Alox5 T C 6: 116,415,456 H368R probably damaging Het
Ano2 T C 6: 126,013,198 F761L probably damaging Het
Aox4 T C 1: 58,263,917 V1169A probably damaging Het
Apbb1ip T A 2: 22,816,984 M11K unknown Het
Arl5a G T 2: 52,412,065 H112Q possibly damaging Het
Ccdc18 C T 5: 108,228,662 T1323I probably benign Het
Cmtm5 G A 14: 54,936,481 probably benign Het
Cul2 T C 18: 3,419,420 Y194H probably benign Het
Daglb T C 5: 143,494,183 I415T possibly damaging Het
Ddx28 A G 8: 106,010,331 V365A probably damaging Het
Dnah6 T C 6: 73,169,080 probably null Het
Eppk1 T A 15: 76,111,746 T312S probably benign Het
Erich4 C A 7: 25,615,285 V68L possibly damaging Het
Fam171a2 G A 11: 102,437,834 P700S probably benign Het
Fat3 T C 9: 15,998,181 N2175S probably damaging Het
Fcrl6 T G 1: 172,598,656 R191S probably damaging Het
Fpgt A G 3: 155,087,830 S187P probably damaging Het
Gapvd1 T G 2: 34,729,122 T80P possibly damaging Het
Gclm A G 3: 122,246,056 N24S probably damaging Het
Gdf15 A G 8: 70,631,347 I89T possibly damaging Het
Gpn2 A G 4: 133,591,382 E306G probably damaging Het
Iars2 A T 1: 185,320,997 L359Q probably damaging Het
Kbtbd4 T G 2: 90,905,896 C84G possibly damaging Het
Manea A G 4: 26,327,910 V377A probably benign Het
Map4 C T 9: 109,999,793 T82I probably damaging Het
Mocos C T 18: 24,664,025 H81Y probably damaging Het
Mtx1 T A 3: 89,212,781 T87S Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Mzt1 C T 14: 99,040,588 C48Y probably damaging Het
Nlrp9b C A 7: 20,024,370 P511T probably benign Het
Noc2l A G 4: 156,237,631 E135G probably benign Het
Nova1 G A 12: 46,720,766 P124L unknown Het
Pax8 T A 2: 24,441,670 T134S probably benign Het
Pde4a T A 9: 21,166,004 L26Q probably damaging Het
Pde6b G A 5: 108,419,518 E254K probably damaging Het
Pdlim7 A G 13: 55,508,931 I70T probably damaging Het
Pinx1 T A 14: 63,864,211 probably null Het
Pomt2 C A 12: 87,130,367 R352L probably damaging Het
Rapgef5 G A 12: 117,721,370 V519I possibly damaging Het
Rnps1 A G 17: 24,418,194 E16G unknown Het
Slc4a5 T C 6: 83,285,872 F782S probably damaging Het
Snap91 A G 9: 86,824,978 V253A possibly damaging Het
Syce3 T C 15: 89,397,341 M32V possibly damaging Het
Tcaf3 C A 6: 42,597,135 V48L probably damaging Het
Tenm4 T C 7: 96,863,533 V1366A probably benign Het
Tnxb G A 17: 34,689,520 M1382I probably benign Het
Tnxb G A 17: 34,689,527 G1385R probably damaging Het
Top3a G T 11: 60,756,380 L238I probably damaging Het
Trim9 A T 12: 70,248,343 N742K probably benign Het
Trp63 T A 16: 25,876,733 Y482N unknown Het
Ttc23 T G 7: 67,670,170 F192V possibly damaging Het
Uck1 A G 2: 32,258,172 V180A probably benign Het
Vwa5b1 G A 4: 138,590,933 T541I probably damaging Het
Zfp456 G T 13: 67,366,794 H264Q probably damaging Het
Zfpm2 T G 15: 40,954,766 V165G possibly damaging Het
Zufsp C T 10: 33,930,155 probably null Het
Other mutations in Myom2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom2 APN 8 15069490 missense probably damaging 1.00
IGL00426:Myom2 APN 8 15069502 missense probably benign 0.00
IGL00503:Myom2 APN 8 15114289 splice site probably null
IGL01515:Myom2 APN 8 15122655 missense probably benign 0.15
IGL01649:Myom2 APN 8 15113755 missense probably benign 0.24
IGL01658:Myom2 APN 8 15077880 missense probably damaging 1.00
IGL01786:Myom2 APN 8 15106330 missense probably damaging 0.99
IGL01924:Myom2 APN 8 15069685 missense probably benign 0.37
IGL01929:Myom2 APN 8 15117698 missense probably damaging 0.96
IGL02016:Myom2 APN 8 15125195 missense probably benign 0.01
IGL02511:Myom2 APN 8 15065743 missense probably benign
IGL02558:Myom2 APN 8 15114237 missense probably benign 0.31
IGL02944:Myom2 APN 8 15104065 critical splice acceptor site probably null
IGL03052:Myom2 APN 8 15123442 splice site probably benign
IGL03195:Myom2 APN 8 15111844 nonsense probably null
IGL03288:Myom2 APN 8 15122679 missense probably damaging 0.99
IGL03402:Myom2 APN 8 15065731 missense probably benign
R0069:Myom2 UTSW 8 15117624 missense probably benign
R0116:Myom2 UTSW 8 15117633 missense probably damaging 1.00
R0131:Myom2 UTSW 8 15083329 missense probably damaging 0.98
R0373:Myom2 UTSW 8 15098419 missense possibly damaging 0.91
R0463:Myom2 UTSW 8 15104123 missense probably benign 0.09
R0544:Myom2 UTSW 8 15069796 missense probably damaging 1.00
R0629:Myom2 UTSW 8 15069783 missense probably damaging 0.98
R0634:Myom2 UTSW 8 15119216 splice site probably benign
R0645:Myom2 UTSW 8 15117698 missense probably damaging 0.96
R0730:Myom2 UTSW 8 15099326 missense probably benign 0.00
R0744:Myom2 UTSW 8 15132924 nonsense probably null
R0836:Myom2 UTSW 8 15132924 nonsense probably null
R1033:Myom2 UTSW 8 15108934 missense probably benign 0.04
R1103:Myom2 UTSW 8 15110827 missense probably benign 0.22
R1110:Myom2 UTSW 8 15122413 missense probably benign 0.44
R1208:Myom2 UTSW 8 15084631 missense probably damaging 1.00
R1208:Myom2 UTSW 8 15084631 missense probably damaging 1.00
R1353:Myom2 UTSW 8 15106424 missense probably damaging 1.00
R1530:Myom2 UTSW 8 15122384 missense probably damaging 1.00
R1544:Myom2 UTSW 8 15104059 splice site probably benign
R1576:Myom2 UTSW 8 15084556 missense probably damaging 1.00
R1758:Myom2 UTSW 8 15065795 missense probably benign 0.00
R1884:Myom2 UTSW 8 15114278 missense probably benign 0.01
R1908:Myom2 UTSW 8 15081023 missense probably damaging 1.00
R1962:Myom2 UTSW 8 15132599 intron probably null
R1977:Myom2 UTSW 8 15085263 missense possibly damaging 0.47
R2018:Myom2 UTSW 8 15131151 missense probably damaging 1.00
R2049:Myom2 UTSW 8 15106379 missense probably damaging 0.97
R2155:Myom2 UTSW 8 15084555 missense probably damaging 0.98
R2314:Myom2 UTSW 8 15063927 missense probably damaging 0.99
R2350:Myom2 UTSW 8 15108835 missense probably benign 0.09
R2358:Myom2 UTSW 8 15112018 missense possibly damaging 0.68
R2904:Myom2 UTSW 8 15098348 missense probably benign 0.00
R3418:Myom2 UTSW 8 15085294 missense probably benign 0.01
R3606:Myom2 UTSW 8 15069775 missense probably damaging 1.00
R3607:Myom2 UTSW 8 15069775 missense probably damaging 1.00
R3735:Myom2 UTSW 8 15069676 missense probably benign 0.01
R3756:Myom2 UTSW 8 15102650 missense probably benign 0.11
R3902:Myom2 UTSW 8 15104165 missense probably benign
R3951:Myom2 UTSW 8 15084556 missense probably benign 0.35
R4240:Myom2 UTSW 8 15132895 missense probably benign 0.10
R4361:Myom2 UTSW 8 15112018 missense possibly damaging 0.68
R4581:Myom2 UTSW 8 15106459 missense probably benign 0.02
R4736:Myom2 UTSW 8 15081271 missense probably damaging 0.99
R5010:Myom2 UTSW 8 15083310 missense probably damaging 0.98
R5108:Myom2 UTSW 8 15132667 missense probably damaging 0.99
R5370:Myom2 UTSW 8 15099343 missense probably benign 0.10
R5427:Myom2 UTSW 8 15113764 missense probably benign 0.03
R5498:Myom2 UTSW 8 15129142 missense probably benign 0.01
R5504:Myom2 UTSW 8 15128879 missense probably damaging 1.00
R5567:Myom2 UTSW 8 15102546 missense probably benign 0.01
R5743:Myom2 UTSW 8 15080914 missense possibly damaging 0.82
R5745:Myom2 UTSW 8 15122705 missense probably benign 0.01
R5844:Myom2 UTSW 8 15131182 critical splice donor site probably null
R5854:Myom2 UTSW 8 15108478 missense probably benign
R6141:Myom2 UTSW 8 15063903 missense probably damaging 1.00
R6209:Myom2 UTSW 8 15104173 missense possibly damaging 0.76
R6248:Myom2 UTSW 8 15098472 splice site probably null
R6378:Myom2 UTSW 8 15099356 missense probably benign 0.11
R6829:Myom2 UTSW 8 15122643 nonsense probably null
R6913:Myom2 UTSW 8 15065710 missense probably benign
R6957:Myom2 UTSW 8 15117741 missense probably null 0.42
R6958:Myom2 UTSW 8 15117741 missense probably null 0.42
R6960:Myom2 UTSW 8 15117741 missense probably null 0.42
R6961:Myom2 UTSW 8 15117741 missense probably null 0.42
R6962:Myom2 UTSW 8 15117741 missense probably null 0.42
R6999:Myom2 UTSW 8 15084531 missense probably benign 0.22
R7148:Myom2 UTSW 8 15084577 missense possibly damaging 0.72
R7210:Myom2 UTSW 8 15104114 missense probably damaging 1.00
R7298:Myom2 UTSW 8 15098411 missense probably damaging 1.00
R7463:Myom2 UTSW 8 15117679 missense probably null 0.94
R7535:Myom2 UTSW 8 15117679 missense probably damaging 1.00
R7573:Myom2 UTSW 8 15122450 missense probably damaging 1.00
R7590:Myom2 UTSW 8 15117679 missense probably damaging 1.00
R7794:Myom2 UTSW 8 15083259 missense probably damaging 1.00
R7822:Myom2 UTSW 8 15108454 missense probably benign
R7948:Myom2 UTSW 8 15085306 missense probably benign 0.00
R8094:Myom2 UTSW 8 15069418 missense possibly damaging 0.94
R8268:Myom2 UTSW 8 15129157 missense probably damaging 1.00
R8292:Myom2 UTSW 8 15132888 missense probably benign 0.01
RF001:Myom2 UTSW 8 15081418 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- AAATGGCATGACCCCAGTC -3'
(R):5'- CACTTGTTCTTGCAGAAGCCG -3'

Sequencing Primer
(F):5'- AGTCAACCAGCTCCCTGAGG -3'
(R):5'- GAAGGTTCACAGCCTCTGAC -3'
Posted On2019-11-12