Incidental Mutation 'R7697:H2-D1'
ID593741
Institutional Source Beutler Lab
Gene Symbol H2-D1
Ensembl Gene ENSMUSG00000073411
Gene Namehistocompatibility 2, D region locus 1
SynonymsH-2D
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R7697 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location35262730-35267499 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35263145 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 11 (L11P)
Ref Sequence ENSEMBL: ENSMUSP00000134570 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172785]
PDB Structure
CRYSTAL STRUCTURE OF MURINE CLASS I MHC H2-DB COMPLEXED WITH A SYNTHETIC PEPTIDE P1027 [X-RAY DIFFRACTION]
MHC CLASS I H-2DB COMPLEXED WITH A SENDAI VIRUS NUCLEOPROTEIN PEPTIDE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MURINE CLASS I H-2DB COMPLEXED WITH PEPTIDE GP33(C9M) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MURINE CLASS I H-2DB COMPLEXED WITH SYNTHETIC PEPTIDE GP33 (C9M/K1A) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MURINE CLASS I H-2DB COMPLEXED WITH PEPTIDE GP33 (C9M/K1S) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE LCMV PEPTIDIC EPITOPE GP33 IN COMPLEX WITH THE MURINE CLASS I MHC MOLECULE H-2DB [X-RAY DIFFRACTION]
THE THREE-DIMENSIONAL STRUCTURE OF H-2DB AT 2.4 ANGSTROMS RESOLUTION: IMPLICATIONS FOR ANTIGEN-DETERMINANT SELECTION [X-RAY DIFFRACTION]
Structure of Minor Histocompatibility Antigen peptide, H13a, complexed to H2-Db [X-RAY DIFFRACTION]
Crystal Structure Of The LCMV Peptidic Epitope Gp276 In Complex With The Murine Class I Mhc Molecule H-2Db [X-RAY DIFFRACTION]
Crystal Structure Of The LCMV Peptidic Epitope Np396 In Complex With The Murine Class I Mhc Molecule H-2Db [X-RAY DIFFRACTION]
>> 46 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000172503
SMART Domains Protein: ENSMUSP00000134582
Gene: ENSMUSG00000073411

DomainStartEndE-ValueType
SCOP:d1hdma1 2 21 3e-8 SMART
Pfam:MHC_I_C 57 81 1.9e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172785
AA Change: L11P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134570
Gene: ENSMUSG00000073411
AA Change: L11P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:MHC_I 25 203 8.3e-93 PFAM
IGc1 222 293 4.73e-23 SMART
transmembrane domain 308 330 N/A INTRINSIC
Pfam:MHC_I_C 337 361 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173167
SMART Domains Protein: ENSMUSP00000133518
Gene: ENSMUSG00000073411

DomainStartEndE-ValueType
SCOP:d1hdma1 2 21 3e-8 SMART
Pfam:MHC_I_C 52 76 1.7e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a spontaneous allele are susceptible to chronic Theiler's Murine Encephalomyelitis Virus (TMEV) infection and demyelination, and lack the ability to respond to the viral peptide VP2121-130, the single Ag driving the protective CD8 T cell response in wild-type B6 mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd4 T C 14: 54,262,759 V87A probably damaging Het
Acadsb A G 7: 131,429,969 E178G probably damaging Het
Acoxl A G 2: 127,978,782 T365A probably benign Het
Adcy8 T G 15: 64,747,001 I768L probably benign Het
Bloc1s4 A G 5: 36,748,615 S11P probably benign Het
Brinp2 T C 1: 158,267,926 I122V probably benign Het
Brwd1 T C 16: 96,046,401 D673G probably benign Het
Cbx8 C A 11: 119,040,811 E14* probably null Het
Cep295 T A 9: 15,354,710 M49L probably benign Het
Cfap157 T C 2: 32,779,753 N273D probably benign Het
Cntn3 A T 6: 102,208,166 V663E probably damaging Het
Cntn3 C T 6: 102,208,167 V663M probably damaging Het
Cspg5 G C 9: 110,256,226 R488S probably damaging Het
Csrnp2 A T 15: 100,488,072 M95K probably damaging Het
Dnah3 A T 7: 119,967,434 V136E Het
Drg2 T A 11: 60,462,177 I212N probably damaging Het
Egfem1 T C 3: 29,690,197 probably null Het
Enpep T A 3: 129,309,101 D402V probably damaging Het
Fanci T A 7: 79,406,292 probably null Het
Fgd6 T A 10: 94,045,444 V720D probably damaging Het
Fhod1 T A 8: 105,347,931 probably benign Het
Flnc T A 6: 29,456,517 I2238N probably damaging Het
Frmd4a A G 2: 4,484,081 E79G probably damaging Het
Gabrr2 A T 4: 33,071,358 Y66F probably benign Het
Ggnbp1 T G 17: 27,030,762 I192S probably benign Het
Gm16368 T C 12: 88,083,979 Y95H probably damaging Het
Gm32742 C T 9: 51,147,601 V1039I probably benign Het
Hsd17b4 A G 18: 50,130,141 Y25C probably damaging Het
Ildr2 C A 1: 166,294,731 Q248K probably benign Het
Klrb1c T C 6: 128,780,310 H264R probably benign Het
Lrp11 C T 10: 7,604,219 A346V probably benign Het
Mast4 G A 13: 102,739,203 P1319L probably damaging Het
Mcm9 A C 10: 53,615,894 F392V Het
Med12l C T 3: 59,240,657 A965V probably damaging Het
Mrps7 A G 11: 115,604,875 T80A probably benign Het
Mtor T A 4: 148,540,308 Y2125* probably null Het
Myoc A G 1: 162,647,480 E200G probably damaging Het
Natd1 A G 11: 60,906,982 V39A probably damaging Het
Notch4 C T 17: 34,570,185 T486I probably damaging Het
Olfr1109 T A 2: 87,092,818 H193L probably benign Het
Olfr1349 T C 7: 6,514,646 Y261C probably damaging Het
Olfr148 A G 9: 39,613,861 Q98R probably damaging Het
Olfr15 G A 16: 3,839,566 V198M probably damaging Het
Pdss2 T A 10: 43,345,548 I152N probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plec T C 15: 76,181,685 E1395G unknown Het
Polr2b T C 5: 77,320,212 Y120H probably damaging Het
Pyroxd2 C T 19: 42,747,366 C99Y probably benign Het
Rela T C 19: 5,641,602 V268A probably damaging Het
Rgs3 C T 4: 62,657,142 P589S probably benign Het
Rtn1 A G 12: 72,408,377 S59P probably benign Het
Siae A G 9: 37,633,654 Y315C probably damaging Het
Susd3 C A 13: 49,237,598 W147L probably damaging Het
Ttn A T 2: 76,871,703 probably null Het
Ubr3 A G 2: 69,897,686 Y131C probably damaging Het
Unc80 C T 1: 66,637,945 P2011L possibly damaging Het
Usp9y T C Y: 1,316,990 E1853G possibly damaging Het
Wls C A 3: 159,911,318 H331Q probably benign Het
Xkr6 C A 14: 63,607,179 P217Q probably damaging Het
Other mutations in H2-D1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02193:H2-D1 APN 17 35265809 missense possibly damaging 0.91
IGL02207:H2-D1 APN 17 35263414 missense possibly damaging 0.94
IGL02949:H2-D1 APN 17 35264088 missense probably benign 0.02
R0627:H2-D1 UTSW 17 35265922 missense probably damaging 1.00
R0904:H2-D1 UTSW 17 35263861 missense probably benign 0.00
R1238:H2-D1 UTSW 17 35263932 missense probably damaging 1.00
R1500:H2-D1 UTSW 17 35263588 missense probably benign 0.01
R1508:H2-D1 UTSW 17 35263868 missense probably damaging 1.00
R1627:H2-D1 UTSW 17 35263495 missense possibly damaging 0.79
R1730:H2-D1 UTSW 17 35263405 missense probably damaging 1.00
R1804:H2-D1 UTSW 17 35263552 missense probably damaging 1.00
R1964:H2-D1 UTSW 17 35263619 missense probably benign 0.06
R2125:H2-D1 UTSW 17 35264115 critical splice donor site probably null
R4652:H2-D1 UTSW 17 35266516 critical splice donor site probably null
R4911:H2-D1 UTSW 17 35265997 missense probably damaging 1.00
R4965:H2-D1 UTSW 17 35263905 missense probably damaging 1.00
R5423:H2-D1 UTSW 17 35265907 missense probably damaging 1.00
R6109:H2-D1 UTSW 17 35263937 missense probably damaging 0.99
R7525:H2-D1 UTSW 17 35265933 missense probably damaging 1.00
R7832:H2-D1 UTSW 17 35263872 missense probably damaging 0.99
R7903:H2-D1 UTSW 17 35263991 missense probably damaging 0.99
R8004:H2-D1 UTSW 17 35266696 missense probably benign 0.00
R8167:H2-D1 UTSW 17 35266765 missense
Predicted Primers PCR Primer
(F):5'- ACTTCTGCACCTAACCTGGG -3'
(R):5'- TCGAAATACCGCATCGAGTGTG -3'

Sequencing Primer
(F):5'- CTGGGTCAGGTCCTTCTGC -3'
(R):5'- CATCGAGTGTGGGCCTG -3'
Posted On2019-11-12