Incidental Mutation 'R7697:Cep295'
ID593715
Institutional Source Beutler Lab
Gene Symbol Cep295
Ensembl Gene ENSMUSG00000046111
Gene Namecentrosomal protein 295
SynonymsLOC382128, 5830418K08Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R7697 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location15316915-15357788 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 15354710 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 49 (M49L)
Ref Sequence ENSEMBL: ENSMUSP00000123788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098979] [ENSMUST00000161132]
Predicted Effect probably damaging
Transcript: ENSMUST00000098979
AA Change: M49L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000096578
Gene: ENSMUSG00000046111
AA Change: M49L

DomainStartEndE-ValueType
low complexity region 159 175 N/A INTRINSIC
coiled coil region 258 288 N/A INTRINSIC
coiled coil region 536 583 N/A INTRINSIC
coiled coil region 861 889 N/A INTRINSIC
internal_repeat_1 890 1104 6.8e-5 PROSPERO
internal_repeat_1 1277 1489 6.8e-5 PROSPERO
low complexity region 1537 1548 N/A INTRINSIC
low complexity region 1611 1625 N/A INTRINSIC
coiled coil region 1707 1736 N/A INTRINSIC
low complexity region 2003 2018 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161132
AA Change: M49L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000123788
Gene: ENSMUSG00000046111
AA Change: M49L

DomainStartEndE-ValueType
low complexity region 111 127 N/A INTRINSIC
coiled coil region 210 240 N/A INTRINSIC
coiled coil region 488 535 N/A INTRINSIC
coiled coil region 813 841 N/A INTRINSIC
coiled coil region 1300 1327 N/A INTRINSIC
low complexity region 1489 1500 N/A INTRINSIC
low complexity region 1563 1577 N/A INTRINSIC
coiled coil region 1659 1688 N/A INTRINSIC
low complexity region 2035 2050 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd4 T C 14: 54,262,759 V87A probably damaging Het
Acadsb A G 7: 131,429,969 E178G probably damaging Het
Acoxl A G 2: 127,978,782 T365A probably benign Het
Adcy8 T G 15: 64,747,001 I768L probably benign Het
Bloc1s4 A G 5: 36,748,615 S11P probably benign Het
Brinp2 T C 1: 158,267,926 I122V probably benign Het
Brwd1 T C 16: 96,046,401 D673G probably benign Het
Cbx8 C A 11: 119,040,811 E14* probably null Het
Cfap157 T C 2: 32,779,753 N273D probably benign Het
Cntn3 A T 6: 102,208,166 V663E probably damaging Het
Cntn3 C T 6: 102,208,167 V663M probably damaging Het
Cspg5 G C 9: 110,256,226 R488S probably damaging Het
Csrnp2 A T 15: 100,488,072 M95K probably damaging Het
Dnah3 A T 7: 119,967,434 V136E Het
Drg2 T A 11: 60,462,177 I212N probably damaging Het
Egfem1 T C 3: 29,690,197 probably null Het
Enpep T A 3: 129,309,101 D402V probably damaging Het
Fanci T A 7: 79,406,292 probably null Het
Fgd6 T A 10: 94,045,444 V720D probably damaging Het
Fhod1 T A 8: 105,347,931 probably benign Het
Flnc T A 6: 29,456,517 I2238N probably damaging Het
Frmd4a A G 2: 4,484,081 E79G probably damaging Het
Gabrr2 A T 4: 33,071,358 Y66F probably benign Het
Ggnbp1 T G 17: 27,030,762 I192S probably benign Het
Gm16368 T C 12: 88,083,979 Y95H probably damaging Het
Gm32742 C T 9: 51,147,601 V1039I probably benign Het
H2-D1 T C 17: 35,263,145 L11P probably damaging Het
Hsd17b4 A G 18: 50,130,141 Y25C probably damaging Het
Ildr2 C A 1: 166,294,731 Q248K probably benign Het
Klrb1c T C 6: 128,780,310 H264R probably benign Het
Lrp11 C T 10: 7,604,219 A346V probably benign Het
Mast4 G A 13: 102,739,203 P1319L probably damaging Het
Mcm9 A C 10: 53,615,894 F392V Het
Med12l C T 3: 59,240,657 A965V probably damaging Het
Mrps7 A G 11: 115,604,875 T80A probably benign Het
Mtor T A 4: 148,540,308 Y2125* probably null Het
Myoc A G 1: 162,647,480 E200G probably damaging Het
Natd1 A G 11: 60,906,982 V39A probably damaging Het
Notch4 C T 17: 34,570,185 T486I probably damaging Het
Olfr1109 T A 2: 87,092,818 H193L probably benign Het
Olfr1349 T C 7: 6,514,646 Y261C probably damaging Het
Olfr148 A G 9: 39,613,861 Q98R probably damaging Het
Olfr15 G A 16: 3,839,566 V198M probably damaging Het
Pdss2 T A 10: 43,345,548 I152N probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plec T C 15: 76,181,685 E1395G unknown Het
Polr2b T C 5: 77,320,212 Y120H probably damaging Het
Pyroxd2 C T 19: 42,747,366 C99Y probably benign Het
Rela T C 19: 5,641,602 V268A probably damaging Het
Rgs3 C T 4: 62,657,142 P589S probably benign Het
Rtn1 A G 12: 72,408,377 S59P probably benign Het
Siae A G 9: 37,633,654 Y315C probably damaging Het
Susd3 C A 13: 49,237,598 W147L probably damaging Het
Ttn A T 2: 76,871,703 probably null Het
Ubr3 A G 2: 69,897,686 Y131C probably damaging Het
Unc80 C T 1: 66,637,945 P2011L possibly damaging Het
Usp9y T C Y: 1,316,990 E1853G possibly damaging Het
Wls C A 3: 159,911,318 H331Q probably benign Het
Xkr6 C A 14: 63,607,179 P217Q probably damaging Het
Other mutations in Cep295
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Cep295 APN 9 15326072 splice site probably null
IGL00769:Cep295 APN 9 15326144 missense probably damaging 1.00
IGL00771:Cep295 APN 9 15322565 missense probably damaging 1.00
IGL00850:Cep295 APN 9 15322852 missense probably benign 0.36
IGL01505:Cep295 APN 9 15318049 missense probably benign 0.08
IGL01510:Cep295 APN 9 15354626 nonsense probably null
IGL01759:Cep295 APN 9 15323559 splice site probably null
IGL02415:Cep295 APN 9 15353020 missense probably damaging 1.00
IGL02447:Cep295 APN 9 15332511 missense probably damaging 0.98
IGL02502:Cep295 APN 9 15350913 splice site probably benign
IGL02665:Cep295 APN 9 15326632 splice site probably benign
IGL02718:Cep295 APN 9 15325753 splice site probably null
IGL02995:Cep295 APN 9 15333312 missense probably damaging 1.00
IGL03024:Cep295 APN 9 15325572 missense probably benign
R0196:Cep295 UTSW 9 15338213 missense probably damaging 0.96
R0398:Cep295 UTSW 9 15354736 missense possibly damaging 0.90
R0595:Cep295 UTSW 9 15332191 nonsense probably null
R0610:Cep295 UTSW 9 15322754 missense possibly damaging 0.81
R0616:Cep295 UTSW 9 15332322 nonsense probably null
R0840:Cep295 UTSW 9 15334315 missense probably benign 0.02
R1215:Cep295 UTSW 9 15327882 missense probably benign 0.00
R1376:Cep295 UTSW 9 15340868 splice site probably benign
R1381:Cep295 UTSW 9 15322565 missense probably benign 0.02
R1484:Cep295 UTSW 9 15334784 missense probably damaging 0.99
R1557:Cep295 UTSW 9 15332010 nonsense probably null
R1655:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1682:Cep295 UTSW 9 15333921 missense probably benign 0.02
R1700:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1734:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1736:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1743:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1765:Cep295 UTSW 9 15327904 missense probably damaging 1.00
R1889:Cep295 UTSW 9 15332103 missense possibly damaging 0.94
R1895:Cep295 UTSW 9 15332103 missense possibly damaging 0.94
R1994:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1995:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R2071:Cep295 UTSW 9 15341564 missense probably damaging 1.00
R2161:Cep295 UTSW 9 15353058 missense probably damaging 0.99
R2195:Cep295 UTSW 9 15332321 missense probably damaging 0.99
R2354:Cep295 UTSW 9 15334784 missense possibly damaging 0.92
R2427:Cep295 UTSW 9 15334238 missense probably damaging 1.00
R2992:Cep295 UTSW 9 15332747 missense probably damaging 1.00
R3873:Cep295 UTSW 9 15333365 missense probably damaging 1.00
R3981:Cep295 UTSW 9 15317067 utr 3 prime probably benign
R4201:Cep295 UTSW 9 15332538 missense probably benign 0.19
R4297:Cep295 UTSW 9 15322654 missense probably benign 0.19
R4543:Cep295 UTSW 9 15335253 missense possibly damaging 0.94
R4584:Cep295 UTSW 9 15334799 missense possibly damaging 0.96
R4724:Cep295 UTSW 9 15330832 missense probably damaging 1.00
R4878:Cep295 UTSW 9 15334956 missense probably benign 0.11
R4884:Cep295 UTSW 9 15351760 missense probably damaging 1.00
R4934:Cep295 UTSW 9 15333160 missense probably damaging 0.97
R4990:Cep295 UTSW 9 15332138 missense probably damaging 1.00
R5057:Cep295 UTSW 9 15322683 missense probably benign 0.00
R5153:Cep295 UTSW 9 15357629 missense probably benign 0.32
R5180:Cep295 UTSW 9 15332120 missense probably benign
R5285:Cep295 UTSW 9 15322591 missense probably benign 0.14
R5360:Cep295 UTSW 9 15326733 missense probably damaging 1.00
R5419:Cep295 UTSW 9 15324237 missense probably damaging 0.98
R5432:Cep295 UTSW 9 15351695 missense possibly damaging 0.95
R5625:Cep295 UTSW 9 15340891 missense probably damaging 0.99
R5637:Cep295 UTSW 9 15333812 splice site probably null
R5645:Cep295 UTSW 9 15332794 missense probably damaging 0.98
R5645:Cep295 UTSW 9 15335108 missense possibly damaging 0.89
R5678:Cep295 UTSW 9 15322858 missense probably damaging 0.99
R5688:Cep295 UTSW 9 15331986 missense probably damaging 1.00
R5807:Cep295 UTSW 9 15332532 missense probably damaging 1.00
R5824:Cep295 UTSW 9 15325656 missense possibly damaging 0.90
R5837:Cep295 UTSW 9 15346984 missense probably damaging 0.99
R5915:Cep295 UTSW 9 15341479 missense probably damaging 1.00
R5988:Cep295 UTSW 9 15341474 missense probably damaging 1.00
R6239:Cep295 UTSW 9 15322631 missense possibly damaging 0.46
R6332:Cep295 UTSW 9 15334914 missense possibly damaging 0.90
R6383:Cep295 UTSW 9 15332754 missense probably damaging 0.99
R6737:Cep295 UTSW 9 15332351 missense possibly damaging 0.90
R6929:Cep295 UTSW 9 15333062 missense probably damaging 1.00
R7428:Cep295 UTSW 9 15333498 missense possibly damaging 0.61
R7963:Cep295 UTSW 9 15333441 missense possibly damaging 0.90
R8055:Cep295 UTSW 9 15333609 missense probably benign 0.00
R8069:Cep295 UTSW 9 15322586 missense possibly damaging 0.94
R8092:Cep295 UTSW 9 15332982 missense probably benign 0.17
R8117:Cep295 UTSW 9 15334364 missense probably damaging 0.99
R8140:Cep295 UTSW 9 15341533 missense probably benign 0.00
R8178:Cep295 UTSW 9 15333540 missense
R8323:Cep295 UTSW 9 15338233 missense possibly damaging 0.53
R8323:Cep295 UTSW 9 15353061 missense probably damaging 0.96
R8339:Cep295 UTSW 9 15325550 missense
R8367:Cep295 UTSW 9 15334530 missense probably benign 0.09
X0065:Cep295 UTSW 9 15322891 missense probably benign 0.36
Z1176:Cep295 UTSW 9 15357697 missense probably damaging 0.99
Z1177:Cep295 UTSW 9 15330817 missense
Predicted Primers PCR Primer
(F):5'- AACCAGGACTCTTTCAAGGACAG -3'
(R):5'- CCAGTGAACTAAAGAGCAGATTCAG -3'

Sequencing Primer
(F):5'- CTCTTTCAAGGACAGAAAAAGCTTG -3'
(R):5'- GGACTTAGTTTACCTGTATACAG -3'
Posted On2019-11-12