Incidental Mutation 'R7697:Myoc'
ID593688
Institutional Source Beutler Lab
Gene Symbol Myoc
Ensembl Gene ENSMUSG00000026697
Gene Namemyocilin
SynonymsTIGR, GLC1A
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7697 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location162639155-162649693 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 162647480 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 200 (E200G)
Ref Sequence ENSEMBL: ENSMUSP00000028020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028020] [ENSMUST00000169439] [ENSMUST00000193898]
Predicted Effect probably damaging
Transcript: ENSMUST00000028020
AA Change: E200G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028020
Gene: ENSMUSG00000026697
AA Change: E200G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
coiled coil region 96 169 N/A INTRINSIC
OLF 232 489 2.54e-161 SMART
Predicted Effect unknown
Transcript: ENSMUST00000169439
AA Change: S134P
SMART Domains Protein: ENSMUSP00000127102
Gene: ENSMUSG00000091060
AA Change: S134P

DomainStartEndE-ValueType
low complexity region 101 113 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000193898
AA Change: S53P
SMART Domains Protein: ENSMUSP00000141822
Gene: ENSMUSG00000091060
AA Change: S53P

DomainStartEndE-ValueType
low complexity region 20 32 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MYOC encodes the protein myocilin, which is believed to have a role in cytoskeletal function. MYOC is expressed in many occular tissues, including the trabecular meshwork, and was revealed to be the trabecular meshwork glucocorticoid-inducible response protein (TIGR). The trabecular meshwork is a specialized eye tissue essential in regulating intraocular pressure, and mutations in MYOC have been identified as the cause of hereditary juvenile-onset open-angle glaucoma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile and display no ocular abnormalities at the light and ultrastructural microscopic levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd4 T C 14: 54,262,759 V87A probably damaging Het
Acadsb A G 7: 131,429,969 E178G probably damaging Het
Acoxl A G 2: 127,978,782 T365A probably benign Het
Adcy8 T G 15: 64,747,001 I768L probably benign Het
Bloc1s4 A G 5: 36,748,615 S11P probably benign Het
Brinp2 T C 1: 158,267,926 I122V probably benign Het
Brwd1 T C 16: 96,046,401 D673G probably benign Het
Cbx8 C A 11: 119,040,811 E14* probably null Het
Cep295 T A 9: 15,354,710 M49L probably benign Het
Cfap157 T C 2: 32,779,753 N273D probably benign Het
Cntn3 A T 6: 102,208,166 V663E probably damaging Het
Cntn3 C T 6: 102,208,167 V663M probably damaging Het
Cspg5 G C 9: 110,256,226 R488S probably damaging Het
Csrnp2 A T 15: 100,488,072 M95K probably damaging Het
Dnah3 A T 7: 119,967,434 V136E Het
Drg2 T A 11: 60,462,177 I212N probably damaging Het
Egfem1 T C 3: 29,690,197 probably null Het
Enpep T A 3: 129,309,101 D402V probably damaging Het
Fanci T A 7: 79,406,292 probably null Het
Fgd6 T A 10: 94,045,444 V720D probably damaging Het
Fhod1 T A 8: 105,347,931 probably benign Het
Flnc T A 6: 29,456,517 I2238N probably damaging Het
Frmd4a A G 2: 4,484,081 E79G probably damaging Het
Gabrr2 A T 4: 33,071,358 Y66F probably benign Het
Ggnbp1 T G 17: 27,030,762 I192S probably benign Het
Gm16368 T C 12: 88,083,979 Y95H probably damaging Het
Gm32742 C T 9: 51,147,601 V1039I probably benign Het
H2-D1 T C 17: 35,263,145 L11P probably damaging Het
Hsd17b4 A G 18: 50,130,141 Y25C probably damaging Het
Ildr2 C A 1: 166,294,731 Q248K probably benign Het
Klrb1c T C 6: 128,780,310 H264R probably benign Het
Lrp11 C T 10: 7,604,219 A346V probably benign Het
Mast4 G A 13: 102,739,203 P1319L probably damaging Het
Mcm9 A C 10: 53,615,894 F392V Het
Med12l C T 3: 59,240,657 A965V probably damaging Het
Mrps7 A G 11: 115,604,875 T80A probably benign Het
Mtor T A 4: 148,540,308 Y2125* probably null Het
Natd1 A G 11: 60,906,982 V39A probably damaging Het
Notch4 C T 17: 34,570,185 T486I probably damaging Het
Olfr1109 T A 2: 87,092,818 H193L probably benign Het
Olfr1349 T C 7: 6,514,646 Y261C probably damaging Het
Olfr148 A G 9: 39,613,861 Q98R probably damaging Het
Olfr15 G A 16: 3,839,566 V198M probably damaging Het
Pdss2 T A 10: 43,345,548 I152N probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plec T C 15: 76,181,685 E1395G unknown Het
Polr2b T C 5: 77,320,212 Y120H probably damaging Het
Pyroxd2 C T 19: 42,747,366 C99Y probably benign Het
Rela T C 19: 5,641,602 V268A probably damaging Het
Rgs3 C T 4: 62,657,142 P589S probably benign Het
Rtn1 A G 12: 72,408,377 S59P probably benign Het
Siae A G 9: 37,633,654 Y315C probably damaging Het
Susd3 C A 13: 49,237,598 W147L probably damaging Het
Ttn A T 2: 76,871,703 probably null Het
Ubr3 A G 2: 69,897,686 Y131C probably damaging Het
Unc80 C T 1: 66,637,945 P2011L possibly damaging Het
Usp9y T C Y: 1,316,990 E1853G possibly damaging Het
Wls C A 3: 159,911,318 H331Q probably benign Het
Xkr6 C A 14: 63,607,179 P217Q probably damaging Het
Other mutations in Myoc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02085:Myoc APN 1 162639774 missense probably benign 0.10
IGL02314:Myoc APN 1 162639348 missense probably damaging 1.00
IGL02707:Myoc APN 1 162639460 missense probably benign 0.28
R0033:Myoc UTSW 1 162648441 missense probably damaging 1.00
R0193:Myoc UTSW 1 162649035 missense probably damaging 1.00
R0573:Myoc UTSW 1 162648674 missense probably damaging 1.00
R1433:Myoc UTSW 1 162648996 missense probably damaging 1.00
R1525:Myoc UTSW 1 162648651 missense probably damaging 1.00
R1637:Myoc UTSW 1 162639367 missense probably damaging 1.00
R2268:Myoc UTSW 1 162649056 missense probably damaging 1.00
R2883:Myoc UTSW 1 162639616 missense possibly damaging 0.76
R4437:Myoc UTSW 1 162649112 missense possibly damaging 0.67
R4845:Myoc UTSW 1 162647465 missense possibly damaging 0.95
R4904:Myoc UTSW 1 162639425 missense probably benign 0.25
R5092:Myoc UTSW 1 162639634 missense probably damaging 1.00
R5629:Myoc UTSW 1 162648587 missense probably damaging 1.00
R5847:Myoc UTSW 1 162639367 missense probably damaging 1.00
R5920:Myoc UTSW 1 162639559 missense probably benign
R6326:Myoc UTSW 1 162649011 missense probably damaging 1.00
R6589:Myoc UTSW 1 162648619 nonsense probably null
R6932:Myoc UTSW 1 162639346 missense probably damaging 1.00
R7282:Myoc UTSW 1 162648844 missense probably benign 0.04
R7698:Myoc UTSW 1 162639445 missense probably damaging 1.00
R7724:Myoc UTSW 1 162639827 critical splice donor site probably null
R7791:Myoc UTSW 1 162649121 missense probably damaging 1.00
R8272:Myoc UTSW 1 162639426 missense probably benign 0.00
R8290:Myoc UTSW 1 162649032 missense possibly damaging 0.51
Z1176:Myoc UTSW 1 162639636 nonsense probably null
Z1176:Myoc UTSW 1 162649154 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCAATGAGCTACCAACGTG -3'
(R):5'- GAACAAGGTATACATGCACACG -3'

Sequencing Primer
(F):5'- CAACGTGGTTCAGTCATGTTAC -3'
(R):5'- CACACACACACAGGGAGGG -3'
Posted On2019-11-12