Incidental Mutation 'R7733:AU040320'
ID595974
Institutional Source Beutler Lab
Gene Symbol AU040320
Ensembl Gene ENSMUSG00000028830
Gene Nameexpressed sequence AU040320
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7733 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location126753544-126870070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126835529 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 495 (N495D)
Ref Sequence ENSEMBL: ENSMUSP00000099667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047431] [ENSMUST00000102607] [ENSMUST00000102608]
Predicted Effect probably damaging
Transcript: ENSMUST00000047431
AA Change: N495D

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037802
Gene: ENSMUSG00000028830
AA Change: N495D

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102607
AA Change: N495D

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099667
Gene: ENSMUSG00000028830
AA Change: N495D

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102608
AA Change: N495D

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099668
Gene: ENSMUSG00000028830
AA Change: N495D

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a candidate gene for dyslexia susceptibility.[provided by RefSeq, Apr 2009]
PHENOTYPE: Null mice display decreased susceptibility to adenoviral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5530400C23Rik T A 6: 133,294,277 S95T probably benign Het
9530053A07Rik A T 7: 28,139,965 D401V probably damaging Het
Abca8a A G 11: 110,054,587 F1070L probably benign Het
Acsl3 G C 1: 78,688,236 probably null Het
Adarb2 T A 13: 8,752,608 S640T possibly damaging Het
Adgre5 T C 8: 83,729,396 D257G probably benign Het
Adora2b A T 11: 62,265,339 I205F possibly damaging Het
Asb14 A G 14: 26,912,352 M505V probably benign Het
Atrnl1 T C 19: 57,701,988 V876A probably benign Het
BC005561 T C 5: 104,519,960 F783L possibly damaging Het
Bcam A T 7: 19,760,388 V361E probably benign Het
Cbwd1 T C 19: 24,940,794 D204G probably damaging Het
Ccdc7a T A 8: 128,993,052 E247V probably damaging Het
Cd84 T A 1: 171,840,659 M1K probably null Het
Cfap43 C T 19: 47,897,993 R61H possibly damaging Het
Clec4a1 A G 6: 122,932,150 D159G possibly damaging Het
Ctcfl C T 2: 173,117,192 R247Q probably benign Het
Ctdnep1 G A 11: 69,990,009 R236Q probably damaging Het
Cwf19l2 A T 9: 3,450,066 H589L probably benign Het
Cyp2u1 G T 3: 131,303,027 A34E probably benign Het
Cyp4x1 A G 4: 115,120,194 S281P possibly damaging Het
Dag1 T C 9: 108,208,848 T365A probably benign Het
Dhx57 A T 17: 80,265,074 probably null Het
Dnajb1 T G 8: 83,608,377 S16A probably benign Het
Dsc2 A T 18: 20,048,315 L145Q probably benign Het
Dsc2 G C 18: 20,048,316 L145V probably benign Het
Eefsec T C 6: 88,376,220 T156A possibly damaging Het
Eif6 T A 2: 155,823,232 D169V probably benign Het
Ell3 C A 2: 121,442,520 G3V possibly damaging Het
Eprs A T 1: 185,397,161 H615L probably benign Het
Fbxw10 A G 11: 62,873,397 Y630C unknown Het
G6pc2 C T 2: 69,220,183 Q51* probably null Het
Glt8d1 C T 14: 31,001,978 probably benign Het
Gm16486 A G 8: 70,717,451 T1397A possibly damaging Het
Gpr4 T C 7: 19,222,710 Y186H probably damaging Het
Grhpr T C 4: 44,981,494 probably benign Het
Gsdma3 A G 11: 98,635,215 H264R probably damaging Het
Hcfc2 A G 10: 82,739,179 Y224C probably benign Het
Helz2 A G 2: 181,230,355 F2608S possibly damaging Het
Herc2 C T 7: 56,188,664 T3313M probably damaging Het
Hmgcl A T 4: 135,960,083 H223L probably benign Het
Igf2r A G 17: 12,739,369 V139A possibly damaging Het
Kif5a T A 10: 127,236,740 T727S probably benign Het
Kifc1 G A 17: 33,883,569 R357W probably damaging Het
Krt81 T A 15: 101,463,514 S62C probably damaging Het
Lgi2 T C 5: 52,538,531 N362S probably benign Het
Lig1 G T 7: 13,296,231 R378L possibly damaging Het
Map3k13 C T 16: 21,921,686 R588C probably damaging Het
Mov10l1 T A 15: 89,024,801 F1008L probably damaging Het
Nr4a2 A G 2: 57,112,321 V40A probably benign Het
Nrde2 A T 12: 100,144,140 C206S possibly damaging Het
Olfr1316 C T 2: 112,130,041 V257I probably benign Het
Parp1 T C 1: 180,600,212 probably null Het
Pcdhb12 A G 18: 37,437,036 T412A probably damaging Het
Plekhh2 T A 17: 84,583,524 Y839* probably null Het
Pnpla6 T A 8: 3,522,660 F316I probably benign Het
Prcp C T 7: 92,901,298 T101M probably damaging Het
Prex2 G T 1: 11,181,959 R1076L probably benign Het
Prpf40b T C 15: 99,308,343 probably null Het
Psd3 T G 8: 68,120,916 K204N possibly damaging Het
Ptpro C A 6: 137,414,286 C801* probably null Het
Ptprt A G 2: 161,575,787 V923A probably damaging Het
Ptprz1 T A 6: 23,000,384 D824E probably benign Het
Rasgrf1 A G 9: 89,981,727 D582G probably benign Het
Rfc2 T C 5: 134,593,216 L183P probably damaging Het
Rnf114 T C 2: 167,512,518 V173A probably damaging Het
Scn3a T A 2: 65,508,650 I562F probably benign Het
Setmar T C 6: 108,076,127 I194T probably damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Sptlc3 G T 2: 139,631,368 M512I possibly damaging Het
Svep1 C A 4: 58,049,239 A3423S probably benign Het
Sycp1 T C 3: 102,895,962 T511A probably benign Het
Tada1 C T 1: 166,389,942 P216L probably damaging Het
Tas2r117 T A 6: 132,803,175 M92K probably benign Het
Thsd1 T C 8: 22,258,721 L536P probably damaging Het
Timp2 T G 11: 118,317,529 probably null Het
Ubqln3 T A 7: 104,141,076 L602F probably damaging Het
Vmn2r59 A G 7: 42,012,019 F791L probably benign Het
Wbp4 A G 14: 79,477,040 probably null Het
Other mutations in AU040320
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:AU040320 APN 4 126792234 missense probably benign
IGL00835:AU040320 APN 4 126757071 splice site probably null
IGL00964:AU040320 APN 4 126854406 nonsense probably null
IGL00978:AU040320 APN 4 126828839 missense probably benign 0.00
IGL01396:AU040320 APN 4 126869378 intron probably benign
IGL02129:AU040320 APN 4 126823692 missense probably damaging 1.00
IGL02148:AU040320 APN 4 126839676 missense possibly damaging 0.64
IGL02179:AU040320 APN 4 126835612 missense probably benign 0.43
IGL02696:AU040320 APN 4 126842587 missense probably damaging 1.00
PIT4677001:AU040320 UTSW 4 126792237 missense probably benign 0.00
R0063:AU040320 UTSW 4 126839672 missense probably damaging 1.00
R0063:AU040320 UTSW 4 126839672 missense probably damaging 1.00
R0356:AU040320 UTSW 4 126837362 missense probably damaging 1.00
R0865:AU040320 UTSW 4 126848884 missense possibly damaging 0.94
R1165:AU040320 UTSW 4 126823640 splice site probably benign
R1216:AU040320 UTSW 4 126816483 splice site probably benign
R1464:AU040320 UTSW 4 126792031 missense possibly damaging 0.92
R1464:AU040320 UTSW 4 126792031 missense possibly damaging 0.92
R1751:AU040320 UTSW 4 126840724 missense probably damaging 1.00
R1767:AU040320 UTSW 4 126840724 missense probably damaging 1.00
R1900:AU040320 UTSW 4 126853280 splice site probably null
R2173:AU040320 UTSW 4 126792276 missense probably benign 0.02
R2414:AU040320 UTSW 4 126868691 critical splice acceptor site probably null
R4061:AU040320 UTSW 4 126835695 missense probably damaging 1.00
R4354:AU040320 UTSW 4 126854399 unclassified probably benign
R4751:AU040320 UTSW 4 126854466 splice site probably null
R4790:AU040320 UTSW 4 126847215 missense possibly damaging 0.62
R4799:AU040320 UTSW 4 126839669 missense probably benign 0.01
R4825:AU040320 UTSW 4 126791793 missense probably damaging 1.00
R4908:AU040320 UTSW 4 126853288 missense probably damaging 1.00
R4914:AU040320 UTSW 4 126835676 nonsense probably null
R5085:AU040320 UTSW 4 126828871 missense possibly damaging 0.83
R5320:AU040320 UTSW 4 126823716 missense possibly damaging 0.52
R5410:AU040320 UTSW 4 126823716 missense possibly damaging 0.52
R5543:AU040320 UTSW 4 126841224 missense probably damaging 1.00
R5684:AU040320 UTSW 4 126792146 missense probably benign 0.06
R5729:AU040320 UTSW 4 126830415 missense probably damaging 1.00
R5918:AU040320 UTSW 4 126814271 missense probably benign 0.32
R6123:AU040320 UTSW 4 126869386 intron probably benign
R6456:AU040320 UTSW 4 126842491 missense probably benign 0.03
R6523:AU040320 UTSW 4 126868760 critical splice donor site probably null
R6591:AU040320 UTSW 4 126836670 missense possibly damaging 0.81
R6603:AU040320 UTSW 4 126792253 missense probably benign 0.02
R6664:AU040320 UTSW 4 126835650 missense probably damaging 1.00
R6691:AU040320 UTSW 4 126836670 missense possibly damaging 0.81
R6864:AU040320 UTSW 4 126847819 missense probably damaging 0.98
R6891:AU040320 UTSW 4 126846438 missense possibly damaging 0.93
R6895:AU040320 UTSW 4 126791930 missense probably damaging 1.00
R7064:AU040320 UTSW 4 126792072 missense probably benign 0.01
R7351:AU040320 UTSW 4 126816444 missense probably damaging 0.98
R7453:AU040320 UTSW 4 126835700 critical splice donor site probably null
R7467:AU040320 UTSW 4 126814310 missense probably benign 0.06
R7492:AU040320 UTSW 4 126847855 missense possibly damaging 0.56
R7513:AU040320 UTSW 4 126792264 missense probably benign 0.01
R7702:AU040320 UTSW 4 126814373 missense probably benign 0.23
Z1177:AU040320 UTSW 4 126842633 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGCGCTAACATTAATGTGCTTC -3'
(R):5'- ATGGAATCAGAGCCTCCCTG -3'

Sequencing Primer
(F):5'- CTTCTGCAGCAGGATGGG -3'
(R):5'- TGTCCCCTGAGAGAGGAGGTATG -3'
Posted On2019-11-12