Incidental Mutation 'R4061:AU040320'
ID315850
Institutional Source Beutler Lab
Gene Symbol AU040320
Ensembl Gene ENSMUSG00000028830
Gene Nameexpressed sequence AU040320
Synonyms
MMRRC Submission 040852-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4061 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location126753544-126870070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 126835695 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 550 (M550K)
Ref Sequence ENSEMBL: ENSMUSP00000037802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047431] [ENSMUST00000102607] [ENSMUST00000102608]
Predicted Effect probably damaging
Transcript: ENSMUST00000047431
AA Change: M550K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037802
Gene: ENSMUSG00000028830
AA Change: M550K

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102607
AA Change: M550K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099667
Gene: ENSMUSG00000028830
AA Change: M550K

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102608
AA Change: M550K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099668
Gene: ENSMUSG00000028830
AA Change: M550K

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155341
Meta Mutation Damage Score 0.8536 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a candidate gene for dyslexia susceptibility.[provided by RefSeq, Apr 2009]
PHENOTYPE: Null mice display decreased susceptibility to adenoviral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Adam25 A G 8: 40,753,782 I28M possibly damaging Het
Anks1b A G 10: 90,307,622 S464G probably damaging Het
Cab39l A G 14: 59,499,607 K59E possibly damaging Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Csmd1 A G 8: 15,945,158 S2626P probably benign Het
Ctss C T 3: 95,543,034 R99W probably benign Het
Deptor A T 15: 55,208,781 M219L probably benign Het
Disp1 A G 1: 183,087,700 V1052A probably damaging Het
Esyt3 C T 9: 99,320,838 S504N probably damaging Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Folh1 T A 7: 86,756,962 Y301F possibly damaging Het
Gm14443 G A 2: 175,169,609 T348I probably benign Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Iars2 A T 1: 185,303,386 H552Q possibly damaging Het
Il18r1 G A 1: 40,474,936 V101I probably benign Het
Impdh2 A G 9: 108,562,804 R182G possibly damaging Het
Krt12 A T 11: 99,416,015 M487K unknown Het
Lmln C A 16: 33,066,391 Y89* probably null Het
Lrrc38 T A 4: 143,350,506 L113Q probably damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Muc5ac A G 7: 141,811,130 D1947G possibly damaging Het
Myh13 A T 11: 67,330,889 I177F possibly damaging Het
Nfasc T C 1: 132,597,845 Y904C probably damaging Het
Obscn G A 11: 59,008,532 P1000S probably damaging Het
Olfr1086 T A 2: 86,676,818 I172F probably damaging Het
Olfr658 T A 7: 104,644,473 K298* probably null Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Pclo A G 5: 14,540,566 E960G unknown Het
Plagl1 TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC 10: 13,128,771 probably benign Het
Prl7a1 T C 13: 27,635,849 I141V possibly damaging Het
Ptpn18 A T 1: 34,472,930 H45L possibly damaging Het
Sbno1 A T 5: 124,388,572 M960K probably damaging Het
Slx4ip T A 2: 137,005,017 S67R probably benign Het
Spata18 A G 5: 73,671,166 K243E probably damaging Het
Tcp1 A G 17: 12,920,863 Q265R probably benign Het
Tec C T 5: 72,823,409 probably benign Het
Thbs4 A G 13: 92,776,097 probably null Het
Tln1 T A 4: 43,549,177 Q635L probably damaging Het
Tshz2 A G 2: 169,962,325 probably benign Het
Uap1 T C 1: 170,158,846 E189G possibly damaging Het
Usp21 G A 1: 171,285,401 probably benign Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Vmn1r38 A T 6: 66,776,848 C95S possibly damaging Het
Vmn2r12 A T 5: 109,092,192 N168K possibly damaging Het
Vmn2r84 T A 10: 130,386,029 E774V probably damaging Het
Other mutations in AU040320
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:AU040320 APN 4 126792234 missense probably benign
IGL00835:AU040320 APN 4 126757071 splice site probably null
IGL00964:AU040320 APN 4 126854406 nonsense probably null
IGL00978:AU040320 APN 4 126828839 missense probably benign 0.00
IGL01396:AU040320 APN 4 126869378 intron probably benign
IGL02129:AU040320 APN 4 126823692 missense probably damaging 1.00
IGL02148:AU040320 APN 4 126839676 missense possibly damaging 0.64
IGL02179:AU040320 APN 4 126835612 missense probably benign 0.43
IGL02696:AU040320 APN 4 126842587 missense probably damaging 1.00
PIT4677001:AU040320 UTSW 4 126792237 missense probably benign 0.00
R0063:AU040320 UTSW 4 126839672 missense probably damaging 1.00
R0063:AU040320 UTSW 4 126839672 missense probably damaging 1.00
R0356:AU040320 UTSW 4 126837362 missense probably damaging 1.00
R0865:AU040320 UTSW 4 126848884 missense possibly damaging 0.94
R1165:AU040320 UTSW 4 126823640 splice site probably benign
R1216:AU040320 UTSW 4 126816483 splice site probably benign
R1464:AU040320 UTSW 4 126792031 missense possibly damaging 0.92
R1464:AU040320 UTSW 4 126792031 missense possibly damaging 0.92
R1751:AU040320 UTSW 4 126840724 missense probably damaging 1.00
R1767:AU040320 UTSW 4 126840724 missense probably damaging 1.00
R1900:AU040320 UTSW 4 126853280 splice site probably null
R2173:AU040320 UTSW 4 126792276 missense probably benign 0.02
R2414:AU040320 UTSW 4 126868691 critical splice acceptor site probably null
R4354:AU040320 UTSW 4 126854399 unclassified probably benign
R4751:AU040320 UTSW 4 126854466 splice site probably null
R4790:AU040320 UTSW 4 126847215 missense possibly damaging 0.62
R4799:AU040320 UTSW 4 126839669 missense probably benign 0.01
R4825:AU040320 UTSW 4 126791793 missense probably damaging 1.00
R4908:AU040320 UTSW 4 126853288 missense probably damaging 1.00
R4914:AU040320 UTSW 4 126835676 nonsense probably null
R5085:AU040320 UTSW 4 126828871 missense possibly damaging 0.83
R5320:AU040320 UTSW 4 126823716 missense possibly damaging 0.52
R5410:AU040320 UTSW 4 126823716 missense possibly damaging 0.52
R5543:AU040320 UTSW 4 126841224 missense probably damaging 1.00
R5684:AU040320 UTSW 4 126792146 missense probably benign 0.06
R5729:AU040320 UTSW 4 126830415 missense probably damaging 1.00
R5918:AU040320 UTSW 4 126814271 missense probably benign 0.32
R6123:AU040320 UTSW 4 126869386 intron probably benign
R6456:AU040320 UTSW 4 126842491 missense probably benign 0.03
R6523:AU040320 UTSW 4 126868760 critical splice donor site probably null
R6591:AU040320 UTSW 4 126836670 missense possibly damaging 0.81
R6603:AU040320 UTSW 4 126792253 missense probably benign 0.02
R6664:AU040320 UTSW 4 126835650 missense probably damaging 1.00
R6691:AU040320 UTSW 4 126836670 missense possibly damaging 0.81
R6864:AU040320 UTSW 4 126847819 missense probably damaging 0.98
R6891:AU040320 UTSW 4 126846438 missense possibly damaging 0.93
R6895:AU040320 UTSW 4 126791930 missense probably damaging 1.00
R7064:AU040320 UTSW 4 126792072 missense probably benign 0.01
R7351:AU040320 UTSW 4 126816444 missense probably damaging 0.98
R7453:AU040320 UTSW 4 126835700 critical splice donor site probably null
R7467:AU040320 UTSW 4 126814310 missense probably benign 0.06
R7492:AU040320 UTSW 4 126847855 missense possibly damaging 0.56
R7513:AU040320 UTSW 4 126792264 missense probably benign 0.01
R7702:AU040320 UTSW 4 126814373 missense probably benign 0.23
R7733:AU040320 UTSW 4 126835529 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGCCTGACTGTGAACAAAGC -3'
(R):5'- AGACAAATTTCTTACCTAGCCTCC -3'

Sequencing Primer
(F):5'- CTGTGAACAAAGCTGTGGACTACC -3'
(R):5'- GCCTCCTAATACTAAAAGTTTCAGG -3'
Posted On2015-05-15