Incidental Mutation 'R7773:Chid1'
ID598713
Institutional Source Beutler Lab
Gene Symbol Chid1
Ensembl Gene ENSMUSG00000025512
Gene Namechitinase domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R7773 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location141493136-141539857 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141529605 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 123 (M123V)
Ref Sequence ENSEMBL: ENSMUSP00000130360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026586] [ENSMUST00000118694] [ENSMUST00000143561] [ENSMUST00000153191] [ENSMUST00000166082] [ENSMUST00000209452]
Predicted Effect probably benign
Transcript: ENSMUST00000026586
AA Change: M123V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000026586
Gene: ENSMUSG00000025512
AA Change: M123V

DomainStartEndE-ValueType
PDB:3BXW|A 4 240 1e-142 PDB
Blast:Glyco_18 82 302 1e-139 BLAST
SCOP:d1e9la1 84 240 1e-15 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000065953
Gene: ENSMUSG00000025512
AA Change: M121V

DomainStartEndE-ValueType
PDB:3BXW|A 3 236 1e-143 PDB
Blast:Glyco_18 81 268 1e-121 BLAST
SCOP:d1e9la1 83 236 2e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118694
AA Change: M120V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000112891
Gene: ENSMUSG00000025512
AA Change: M120V

DomainStartEndE-ValueType
PDB:3BXW|A 1 237 1e-142 PDB
Blast:Glyco_18 79 299 1e-139 BLAST
SCOP:d1e9la1 81 237 1e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143561
AA Change: M120V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000115174
Gene: ENSMUSG00000025512
AA Change: M120V

DomainStartEndE-ValueType
low complexity region 22 32 N/A INTRINSIC
Pfam:Glyco_hydro_18 79 263 4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153191
AA Change: M120V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000114693
Gene: ENSMUSG00000025512
AA Change: M120V

DomainStartEndE-ValueType
low complexity region 22 32 N/A INTRINSIC
Glyco_18 79 385 3.54e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166082
AA Change: M123V

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000130360
Gene: ENSMUSG00000025512
AA Change: M123V

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Glyco_18 82 388 3.54e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209452
AA Change: M120V

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,412,531 I336T probably benign Het
4930519P11Rik T C 2: 154,613,187 Y84C unknown Het
4930568D16Rik C T 2: 35,354,594 G249S probably damaging Het
4933425L06Rik A G 13: 105,082,285 I42M probably damaging Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Agbl1 T A 7: 76,698,837 V894E unknown Het
Amigo3 T C 9: 108,054,668 L430P probably benign Het
Aoc1 A G 6: 48,906,212 I341V probably benign Het
Bod1l A G 5: 41,832,712 S223P probably benign Het
Cacnb3 T C 15: 98,639,938 probably null Het
Ccdc63 G T 5: 122,109,272 N503K probably damaging Het
Ccdc83 T A 7: 90,229,912 I225F probably damaging Het
Cd200r1 A G 16: 44,789,687 T90A possibly damaging Het
Cd8a A G 6: 71,373,815 N88S probably benign Het
Cep170 A G 1: 176,740,076 V152A Het
Cnnm4 T C 1: 36,499,522 V595A probably benign Het
Coro7 A G 16: 4,632,006 L630P probably damaging Het
Cpvl A G 6: 53,931,905 probably null Het
Edem3 A T 1: 151,811,596 K762* probably null Het
Elp6 T A 9: 110,312,559 probably null Het
Emilin3 A T 2: 160,910,798 Y77* probably null Het
Fam234b T A 6: 135,243,914 I641N probably benign Het
Farsa T C 8: 84,864,152 probably null Het
Foxf2 T C 13: 31,627,199 S374P probably benign Het
Gm11596 A T 11: 99,792,841 I151N unknown Het
Gm13178 A T 4: 144,703,477 L314Q probably damaging Het
Gm853 T C 4: 130,220,376 N83D probably damaging Het
Gm9817 C T 13: 45,078,951 Q77* probably null Het
Gon4l A G 3: 88,895,795 K1238E probably benign Het
H13 A G 2: 152,695,511 Y292C probably damaging Het
Hip1r A G 5: 124,001,441 N928S probably benign Het
Iqcf4 T C 9: 106,568,613 N112D probably benign Het
Jak3 A C 8: 71,679,042 T125P probably benign Het
Krt7 A C 15: 101,414,032 K124Q possibly damaging Het
Lrrc66 G A 5: 73,607,321 S793F probably damaging Het
Mycbp2 C T 14: 103,248,404 V1074I probably damaging Het
Nckap5 T C 1: 126,026,844 D657G probably benign Het
Olfr1053 T C 2: 86,314,690 I199V probably benign Het
Olfr1467 T A 19: 13,365,234 V202E probably benign Het
Osbpl7 A G 11: 97,050,722 S24G probably benign Het
Pcm1 G T 8: 41,309,573 E1385* probably null Het
Poc5 A G 13: 96,410,635 T469A probably damaging Het
Ppp3ca A G 3: 136,890,461 T296A probably benign Het
Prl6a1 T C 13: 27,318,142 I164T probably damaging Het
Psmd6 GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC 14: 14,119,882 probably null Het
Rnf149 A C 1: 39,565,218 M188R possibly damaging Het
Rpl10l T C 12: 66,284,267 I31V probably benign Het
Serinc5 T C 13: 92,661,084 S32P probably damaging Het
Sirt1 T A 10: 63,326,783 K137M possibly damaging Het
Smc4 A G 3: 69,016,163 Y251C probably damaging Het
Sod3 A C 5: 52,368,301 E114A possibly damaging Het
Tgfbr3 A G 5: 107,140,502 V431A probably benign Het
Tlr4 T C 4: 66,839,599 S210P probably damaging Het
Trub2 G T 2: 29,786,508 T70N probably benign Het
Tsga10 A T 1: 37,835,242 C159S unknown Het
Vmn1r15 A T 6: 57,258,659 I171F probably benign Het
Vmn2r50 T A 7: 10,037,635 H713L possibly damaging Het
Zcchc14 T C 8: 121,651,775 S43G unknown Het
Zfp638 T C 6: 83,979,214 I1601T probably damaging Het
Other mutations in Chid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Chid1 APN 7 141522696 missense probably damaging 1.00
IGL01095:Chid1 APN 7 141530229 missense probably damaging 1.00
IGL01382:Chid1 APN 7 141530253 missense probably damaging 1.00
IGL01505:Chid1 APN 7 141513894 splice site probably null
IGL02108:Chid1 APN 7 141532928 start codon destroyed probably null 0.98
IGL02216:Chid1 APN 7 141496593 splice site probably benign
IGL02574:Chid1 APN 7 141496690 splice site probably benign
R0006:Chid1 UTSW 7 141496426 splice site probably benign
R0006:Chid1 UTSW 7 141496426 splice site probably benign
R0711:Chid1 UTSW 7 141496677 missense probably benign
R1518:Chid1 UTSW 7 141528471 missense probably damaging 0.98
R1836:Chid1 UTSW 7 141526496 splice site probably null
R5026:Chid1 UTSW 7 141513836 missense probably damaging 0.99
R5516:Chid1 UTSW 7 141496146 missense probably damaging 1.00
R5811:Chid1 UTSW 7 141530253 missense probably damaging 1.00
R6009:Chid1 UTSW 7 141529580 missense probably damaging 1.00
R6182:Chid1 UTSW 7 141528502 missense probably benign 0.08
R6238:Chid1 UTSW 7 141496136 missense probably benign 0.03
R6966:Chid1 UTSW 7 141496384 missense possibly damaging 0.89
R7106:Chid1 UTSW 7 141522660 missense probably benign 0.01
R7278:Chid1 UTSW 7 141529488 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACATTCACACTGCTACTCATTAGTC -3'
(R):5'- CATGTCCAGAGCATCAGGTGAC -3'

Sequencing Primer
(F):5'- TAATACACAACCTGGCTAGCTGTGG -3'
(R):5'- AGCATCAGGTGACAGCATC -3'
Posted On2019-11-26