Mutagenetix > Incidental Mutations

Incidental Mutation 'R7773:Adprhl1'

598714

Institutional Source

Beutler Lab

Gene Symbol

Adprhl1

Ensembl Gene

ENSMUSG00000031448

Gene Name

ADP-ribosylhydrolase like 1

Synonyms

Arh2, D330008N11Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7773 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

13221663-13254162 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 13248682 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 83 (V83I)

Ref Sequence

ENSEMBL: ENSMUSP00000033825 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033825] [ENSMUST00000168498] [ENSMUST00000171619] [ENSMUST00000204916]

Predicted Effect

probably damaging
Transcript: ENSMUST00000033825
AA Change: V83I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000033825
Gene: ENSMUSG00000031448
AA Change: V83I

Domain	Start	End	E-Value	Type
Pfam:ADP_ribosyl_GH	6	327	1.2e-53	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000168498

SMART Domains

Protein: ENSMUSP00000131920
Gene: ENSMUSG00000031448

Domain	Start	End	E-Value	Type
Pfam:ADP_ribosyl_GH	69	196	9e-17	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000171619
AA Change: V2I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000132014
Gene: ENSMUSG00000031448
AA Change: V2I

Domain	Start	End	E-Value	Type
Pfam:ADP_ribosyl_GH	1	135	4.9e-18	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000204916
AA Change: V83I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000145145
Gene: ENSMUSG00000031448
AA Change: V83I

Domain	Start	End	E-Value	Type
Pfam:ADP_ribosyl_GH	6	327	4.2e-49	PFAM
low complexity region	509	527	N/A	INTRINSIC
low complexity region	955	969	N/A	INTRINSIC
internal_repeat_1	1047	1150	1.82e-5	PROSPERO
internal_repeat_1	1157	1274	1.82e-5	PROSPERO
low complexity region	1275	1290	N/A	INTRINSIC

Meta Mutation Damage Score

0.6329

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation is a reversible posttranslational modification used to regulate protein function. ADP-ribosyltransferases (see ART1; MIM 601625) transfer ADP-ribose from NAD+ to the target protein, and ADP-ribosylhydrolases, such as ADPRHL1, reverse the reaction (Glowacki et al., 2002 [PubMed 12070318]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	G	3: 124,412,531	I336T	probably benign	Het
4930519P11Rik	T	C	2: 154,613,187	Y84C	unknown	Het
4930568D16Rik	C	T	2: 35,354,594	G249S	probably damaging	Het
4933425L06Rik	A	G	13: 105,082,285	I42M	probably damaging	Het
Agbl1	T	A	7: 76,698,837	V894E	unknown	Het
Amigo3	T	C	9: 108,054,668	L430P	probably benign	Het
Aoc1	A	G	6: 48,906,212	I341V	probably benign	Het
Bod1l	A	G	5: 41,832,712	S223P	probably benign	Het
Cacnb3	T	C	15: 98,639,938		probably null	Het
Ccdc63	G	T	5: 122,109,272	N503K	probably damaging	Het
Ccdc83	T	A	7: 90,229,912	I225F	probably damaging	Het
Cd200r1	A	G	16: 44,789,687	T90A	possibly damaging	Het
Cd8a	A	G	6: 71,373,815	N88S	probably benign	Het
Cep170	A	G	1: 176,740,076	V152A		Het
Chid1	T	C	7: 141,529,605	M123V	probably benign	Het
Cnnm4	T	C	1: 36,499,522	V595A	probably benign	Het
Coro7	A	G	16: 4,632,006	L630P	probably damaging	Het
Cpvl	A	G	6: 53,931,905		probably null	Het
Edem3	A	T	1: 151,811,596	K762*	probably null	Het
Elp6	T	A	9: 110,312,559		probably null	Het
Emilin3	A	T	2: 160,910,798	Y77*	probably null	Het
Fam234b	T	A	6: 135,243,914	I641N	probably benign	Het
Farsa	T	C	8: 84,864,152		probably null	Het
Foxf2	T	C	13: 31,627,199	S374P	probably benign	Het
Gm11596	A	T	11: 99,792,841	I151N	unknown	Het
Gm13178	A	T	4: 144,703,477	L314Q	probably damaging	Het
Gm853	T	C	4: 130,220,376	N83D	probably damaging	Het
Gm9817	C	T	13: 45,078,951	Q77*	probably null	Het
Gon4l	A	G	3: 88,895,795	K1238E	probably benign	Het
H13	A	G	2: 152,695,511	Y292C	probably damaging	Het
Hip1r	A	G	5: 124,001,441	N928S	probably benign	Het
Iqcf4	T	C	9: 106,568,613	N112D	probably benign	Het
Jak3	A	C	8: 71,679,042	T125P	probably benign	Het
Krt7	A	C	15: 101,414,032	K124Q	possibly damaging	Het
Lrrc66	G	A	5: 73,607,321	S793F	probably damaging	Het
Mycbp2	C	T	14: 103,248,404	V1074I	probably damaging	Het
Nckap5	T	C	1: 126,026,844	D657G	probably benign	Het
Olfr1053	T	C	2: 86,314,690	I199V	probably benign	Het
Olfr1467	T	A	19: 13,365,234	V202E	probably benign	Het
Osbpl7	A	G	11: 97,050,722	S24G	probably benign	Het
Pcm1	G	T	8: 41,309,573	E1385*	probably null	Het
Poc5	A	G	13: 96,410,635	T469A	probably damaging	Het
Ppp3ca	A	G	3: 136,890,461	T296A	probably benign	Het
Prl6a1	T	C	13: 27,318,142	I164T	probably damaging	Het
Psmd6	GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC	GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC	14: 14,119,882		probably null	Het
Rnf149	A	C	1: 39,565,218	M188R	possibly damaging	Het
Rpl10l	T	C	12: 66,284,267	I31V	probably benign	Het
Serinc5	T	C	13: 92,661,084	S32P	probably damaging	Het
Sirt1	T	A	10: 63,326,783	K137M	possibly damaging	Het
Smc4	A	G	3: 69,016,163	Y251C	probably damaging	Het
Sod3	A	C	5: 52,368,301	E114A	possibly damaging	Het
Tgfbr3	A	G	5: 107,140,502	V431A	probably benign	Het
Tlr4	T	C	4: 66,839,599	S210P	probably damaging	Het
Trub2	G	T	2: 29,786,508	T70N	probably benign	Het
Tsga10	A	T	1: 37,835,242	C159S	unknown	Het
Vmn1r15	A	T	6: 57,258,659	I171F	probably benign	Het
Vmn2r50	T	A	7: 10,037,635	H713L	possibly damaging	Het
Zcchc14	T	C	8: 121,651,775	S43G	unknown	Het
Zfp638	T	C	6: 83,979,214	I1601T	probably damaging	Het

Other mutations in Adprhl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03268:Adprhl1	APN	8	13246170	splice site	probably benign
BB003:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB004:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB005:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB006:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB013:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB014:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB015:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB016:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R0244:Adprhl1	UTSW	8	13242391	splice site	probably benign
R0636:Adprhl1	UTSW	8	13248702	missense	probably damaging	1.00
R1295:Adprhl1	UTSW	8	13248624	missense	probably damaging	1.00
R2111:Adprhl1	UTSW	8	13248694	missense	probably damaging	1.00
R2112:Adprhl1	UTSW	8	13248694	missense	probably damaging	1.00
R2184:Adprhl1	UTSW	8	13242559	missense	probably benign	0.00
R4411:Adprhl1	UTSW	8	13246114	missense	probably benign	0.16
R4412:Adprhl1	UTSW	8	13246114	missense	probably benign	0.16
R4413:Adprhl1	UTSW	8	13246114	missense	probably benign	0.16
R4615:Adprhl1	UTSW	8	13242250	critical splice donor site	probably null
R4618:Adprhl1	UTSW	8	13242250	critical splice donor site	probably null
R5016:Adprhl1	UTSW	8	13224889	missense	possibly damaging	0.88
R5058:Adprhl1	UTSW	8	13242625	missense	probably damaging	1.00
R5060:Adprhl1	UTSW	8	13248621	missense	possibly damaging	0.63
R5209:Adprhl1	UTSW	8	13242563	nonsense	probably null
R6103:Adprhl1	UTSW	8	13222055	missense	possibly damaging	0.91
R6158:Adprhl1	UTSW	8	13224977	missense	possibly damaging	0.93
R6221:Adprhl1	UTSW	8	13225634	missense	probably benign	0.01
R6971:Adprhl1	UTSW	8	13223476	missense	probably benign
R7087:Adprhl1	UTSW	8	13221856	missense	probably damaging	0.99
R7362:Adprhl1	UTSW	8	13245534	missense	probably damaging	1.00
R7404:Adprhl1	UTSW	8	13225118	missense	probably damaging	0.99
R7422:Adprhl1	UTSW	8	13222873	missense	probably benign	0.28
R7439:Adprhl1	UTSW	8	13223069	missense	probably benign	0.01
R7441:Adprhl1	UTSW	8	13223069	missense	probably benign	0.01
R7772:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7774:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7776:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7876:Adprhl1	UTSW	8	13223509	missense	probably benign	0.00
R7877:Adprhl1	UTSW	8	13225316	nonsense	probably null
R7926:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7927:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7928:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7929:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7944:Adprhl1	UTSW	8	13221929	missense	probably damaging	0.99
R7945:Adprhl1	UTSW	8	13221929	missense	probably damaging	0.99
R7946:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7947:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7949:Adprhl1	UTSW	8	13224225	missense	possibly damaging	0.93
R8155:Adprhl1	UTSW	8	13221764	missense	probably damaging	0.99
R8182:Adprhl1	UTSW	8	13222774	missense	probably benign	0.07
Z1176:Adprhl1	UTSW	8	13225613	missense	probably benign	0.01
Z1177:Adprhl1	UTSW	8	13245476	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- GGAATACCACACCAAGTGTCG -3'
(R):5'- TGGATGTTCCCTAGACCCTC -3'

Sequencing Primer
(F):5'- TTCACACGCACAGGGTC -3'
(R):5'- ATGTTCCCTAGACCCTCGGGAC -3'

Posted On

2019-11-26