Incidental Mutation 'R7801:Trpm5'
List |< first << previous [record 41 of 47] next >> last >|
ID600533
Institutional Source Beutler Lab
Gene Symbol Trpm5
Ensembl Gene ENSMUSG00000009246
Gene Nametransient receptor potential cation channel, subfamily M, member 5
Synonyms9430099A16Rik, Mtr1, Ltrpc5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R7801 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location143069153-143094642 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 143085241 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 264 (D264E)
Ref Sequence ENSEMBL: ENSMUSP00000009390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009390] [ENSMUST00000150867]
Predicted Effect probably damaging
Transcript: ENSMUST00000009390
AA Change: D264E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000009390
Gene: ENSMUSG00000009246
AA Change: D264E

DomainStartEndE-ValueType
Blast:ANK 382 411 2e-6 BLAST
transmembrane domain 644 666 N/A INTRINSIC
Pfam:Ion_trans 736 989 1.2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150867
AA Change: D264E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114302
Gene: ENSMUSG00000009246
AA Change: D264E

DomainStartEndE-ValueType
Blast:ANK 382 411 2e-6 BLAST
transmembrane domain 644 666 N/A INTRINSIC
transmembrane domain 731 753 N/A INTRINSIC
transmembrane domain 811 833 N/A INTRINSIC
transmembrane domain 872 894 N/A INTRINSIC
transmembrane domain 952 974 N/A INTRINSIC
Meta Mutation Damage Score 0.4597 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential (TRP) protein family, which is a diverse group of proteins with structural features typical of ion channels. This protein plays an important role in taste transduction, and has characteristics of a calcium-activated, non-selective cation channel that carries Na+, K+, and Cs+ ions equally well, but not Ca(2+) ions. It is activated by lower concentrations of intracellular Ca(2+), and inhibited by higher concentrations. It is also a highly temperature-sensitive, heat activated channel showing a steep increase of inward currents at temperatures between 15 and 35 degrees Celsius. This gene is located within the Beckwith-Wiedemann syndrome critical region-1 on chromosome 11p15.5, and has been shown to be imprinted, with exclusive expression from the paternal allele. [provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygous mutant mice demonstrate abnormal taste perception, responding to sour and salty stimuli but not to sweet, or bitter stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,630,485 Y165C probably damaging Het
Agbl3 A T 6: 34,839,365 T742S probably benign Het
Arhgef10l T C 4: 140,544,267 T651A probably benign Het
Arsb T A 13: 93,862,327 I381N probably damaging Het
Blzf1 A G 1: 164,295,909 V283A probably benign Het
C130060K24Rik T A 6: 65,441,217 V123D probably damaging Het
Cadps C T 14: 12,489,476 probably null Het
Casz1 A T 4: 148,938,249 T591S probably damaging Het
Ccne2 T C 4: 11,194,079 probably null Het
Chst9 T C 18: 15,452,277 T410A probably benign Het
Ciart G A 3: 95,881,344 P61L probably damaging Het
Fam234a T C 17: 26,218,198 D169G probably benign Het
Fat1 C T 8: 45,042,223 P4116L probably damaging Het
Fbxo21 G T 5: 117,986,124 A166S probably damaging Het
Gbf1 A G 19: 46,272,643 I1216V probably benign Het
Gper1 G A 5: 139,426,688 A263T probably benign Het
Hdlbp G T 1: 93,430,307 probably null Het
Ighg3 A T 12: 113,359,816 L280Q Het
Impa1 T C 3: 10,321,667 T171A probably benign Het
Ints7 T A 1: 191,615,747 Y744N possibly damaging Het
Irgc1 G T 7: 24,432,534 A286D probably damaging Het
Kif18a T C 2: 109,287,845 S2P probably damaging Het
Macf1 A T 4: 123,408,271 W813R probably damaging Het
Mapkbp1 T G 2: 120,012,073 H157Q probably damaging Het
Mfsd4b2 T A 10: 39,923,781 M42L probably benign Het
Mon2 A G 10: 123,059,186 probably null Het
Myrfl T A 10: 116,848,335 H161L probably benign Het
Olfr171 T C 16: 19,624,623 H159R probably damaging Het
Olfr832 A C 9: 18,945,259 S204R probably damaging Het
Phlpp2 T G 8: 109,925,842 V606G possibly damaging Het
Psmb5 T C 14: 54,616,755 T89A probably benign Het
Ptpn9 A G 9: 57,061,013 T546A probably benign Het
Rabep2 A G 7: 126,438,412 M146V possibly damaging Het
Rptn G A 3: 93,398,224 E955K possibly damaging Het
Samd3 G T 10: 26,263,872 V301F possibly damaging Het
Sh2b1 C A 7: 126,471,292 C380F probably benign Het
Shank1 A G 7: 44,351,598 M914V unknown Het
Sox2 G A 3: 34,650,642 R76H probably damaging Het
Stat5a T C 11: 100,880,317 F574S probably damaging Het
Tbx5 A G 5: 119,836,999 E29G probably benign Het
Zfp442 T C 2: 150,409,719 S88G probably benign Het
Zfp62 T A 11: 49,217,328 F749I possibly damaging Het
Zfp677 T A 17: 21,398,015 S445T probably damaging Het
Zfp979 A C 4: 147,613,978 N91K probably damaging Het
Zfyve9 A G 4: 108,684,995 V209A possibly damaging Het
Zic4 G T 9: 91,384,244 A314S probably benign Het
Other mutations in Trpm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Trpm5 APN 7 143082991 missense probably benign 0.03
IGL00717:Trpm5 APN 7 143073990 missense probably damaging 1.00
IGL01138:Trpm5 APN 7 143074569 missense probably benign
IGL01590:Trpm5 APN 7 143082734 missense probably damaging 0.99
IGL01603:Trpm5 APN 7 143075601 missense probably benign 0.04
IGL01685:Trpm5 APN 7 143082354 missense probably benign 0.05
IGL01878:Trpm5 APN 7 143074497 missense probably damaging 1.00
IGL02533:Trpm5 APN 7 143089545 missense probably benign 0.01
IGL02572:Trpm5 APN 7 143087876 splice site probably benign
IGL02750:Trpm5 APN 7 143074484 missense possibly damaging 0.89
IGL02862:Trpm5 APN 7 143082525 missense probably damaging 1.00
R0032:Trpm5 UTSW 7 143085241 missense probably damaging 1.00
R0238:Trpm5 UTSW 7 143082958 missense probably damaging 1.00
R0238:Trpm5 UTSW 7 143082958 missense probably damaging 1.00
R0239:Trpm5 UTSW 7 143082958 missense probably damaging 1.00
R0239:Trpm5 UTSW 7 143082958 missense probably damaging 1.00
R0334:Trpm5 UTSW 7 143086876 missense probably benign 0.06
R0799:Trpm5 UTSW 7 143078351 missense probably damaging 0.99
R1187:Trpm5 UTSW 7 143074469 missense probably damaging 0.96
R1373:Trpm5 UTSW 7 143086842 splice site probably benign
R1521:Trpm5 UTSW 7 143082889 missense probably benign 0.00
R1603:Trpm5 UTSW 7 143085209 missense probably benign 0.00
R1606:Trpm5 UTSW 7 143085171 nonsense probably null
R2009:Trpm5 UTSW 7 143087738 missense possibly damaging 0.58
R2437:Trpm5 UTSW 7 143082561 missense probably benign 0.03
R2508:Trpm5 UTSW 7 143088919 missense possibly damaging 0.80
R2516:Trpm5 UTSW 7 143074517 missense probably damaging 1.00
R2985:Trpm5 UTSW 7 143082938 missense probably damaging 0.99
R3036:Trpm5 UTSW 7 143085463 missense probably benign 0.00
R3037:Trpm5 UTSW 7 143085463 missense probably benign 0.00
R3688:Trpm5 UTSW 7 143078456 missense probably damaging 0.98
R4156:Trpm5 UTSW 7 143089055 missense probably benign 0.04
R4734:Trpm5 UTSW 7 143082785 missense probably benign 0.04
R4811:Trpm5 UTSW 7 143080219 missense probably damaging 1.00
R4814:Trpm5 UTSW 7 143082636 missense possibly damaging 0.50
R4847:Trpm5 UTSW 7 143087763 missense possibly damaging 0.89
R5055:Trpm5 UTSW 7 143072784 missense probably benign 0.00
R5256:Trpm5 UTSW 7 143082303 missense probably damaging 1.00
R5413:Trpm5 UTSW 7 143080968 missense probably damaging 1.00
R5668:Trpm5 UTSW 7 143073229 missense probably benign 0.39
R6133:Trpm5 UTSW 7 143088951 missense probably damaging 0.98
R6242:Trpm5 UTSW 7 143073182 missense probably benign
R6564:Trpm5 UTSW 7 143072770 missense probably damaging 1.00
R6702:Trpm5 UTSW 7 143069318 unclassified probably benign
R6703:Trpm5 UTSW 7 143069318 unclassified probably benign
R6829:Trpm5 UTSW 7 143069429 unclassified probably benign
R6940:Trpm5 UTSW 7 143084810 nonsense probably null
R7337:Trpm5 UTSW 7 143089019 missense probably benign 0.01
R7513:Trpm5 UTSW 7 143081835 missense possibly damaging 0.84
R7560:Trpm5 UTSW 7 143080986 missense probably damaging 1.00
R7961:Trpm5 UTSW 7 143080369 missense probably benign 0.00
R8009:Trpm5 UTSW 7 143080369 missense probably benign 0.00
R8189:Trpm5 UTSW 7 143081838 missense probably benign 0.32
R8441:Trpm5 UTSW 7 143072434 missense possibly damaging 0.75
R8507:Trpm5 UTSW 7 143078313 missense probably damaging 1.00
X0022:Trpm5 UTSW 7 143083042 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTCTGCTACACAAGGACCTG -3'
(R):5'- TGGAGCCCTGAAGGATATGG -3'

Sequencing Primer
(F):5'- GCTACACAAGGACCTGGATAATTCTG -3'
(R):5'- GTAGTTTCTCAGGGCATCTACAG -3'
Posted On2019-11-26