Incidental Mutation 'R7802:Galnt16'
ID600581
Institutional Source Beutler Lab
Gene Symbol Galnt16
Ensembl Gene ENSMUSG00000021130
Gene Namepolypeptide N-acetylgalactosaminyltransferase 16
Synonyms5730405L21Rik, Galntl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R7802 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location80518277-80630972 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 80581247 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 239 (I239S)
Ref Sequence ENSEMBL: ENSMUSP00000021558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021558] [ENSMUST00000218943] [ENSMUST00000219993]
Predicted Effect probably damaging
Transcript: ENSMUST00000021558
AA Change: I239S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021558
Gene: ENSMUSG00000021130
AA Change: I239S

DomainStartEndE-ValueType
transmembrane domain 7 25 N/A INTRINSIC
low complexity region 29 46 N/A INTRINSIC
Pfam:Glycos_transf_2 126 308 1.2e-24 PFAM
Pfam:Glyco_tranf_2_2 126 356 1.6e-9 PFAM
Pfam:Glyco_transf_7C 277 352 2.2e-10 PFAM
Blast:RICIN 362 395 1e-10 BLAST
RICIN 432 555 1.41e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000218943
AA Change: I239S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000219993
AA Change: I239S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6981 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
Abl1 T C 2: 31,760,426 V12A probably benign Het
Bahcc1 T C 11: 120,274,692 F983S probably benign Het
Cecr2 T C 6: 120,743,847 I312T probably benign Het
Col6a2 A T 10: 76,603,798 W711R probably damaging Het
Epb41l4a A G 18: 33,828,174 F436L probably benign Het
Epha1 C T 6: 42,361,941 R641Q possibly damaging Het
Ercc6 C A 14: 32,517,303 A116E probably damaging Het
Ermard A G 17: 15,061,161 E611G probably benign Het
Gna15 T C 10: 81,514,341 R76G probably benign Het
Herc2 A G 7: 56,164,090 Y2657C probably damaging Het
Mapkapk2 T C 1: 131,056,902 I238V possibly damaging Het
Med13l T C 5: 118,728,590 S570P probably benign Het
Mettl7a1 A T 15: 100,305,301 N152I possibly damaging Het
Mrap C T 16: 90,749,359 T112M probably benign Het
Nadsyn1 T C 7: 143,806,026 Q403R probably benign Het
Nostrin T C 2: 69,189,012 V467A probably benign Het
Palb2 A T 7: 122,110,896 probably null Het
Parp16 A G 9: 65,229,897 N135S probably benign Het
Pcnt A T 10: 76,375,303 probably null Het
Pde8b T C 13: 95,100,938 D116G probably damaging Het
Psmc5 T C 11: 106,261,712 probably null Het
Rsf1 G T 7: 97,661,772 V570F Het
Rundc3a A G 11: 102,400,009 E306G probably benign Het
Serpinb6b C T 13: 32,971,596 Het
Setx A G 2: 29,147,021 T1173A probably benign Het
Slamf8 A G 1: 172,588,110 S54P probably damaging Het
Slc5a2 A C 7: 128,271,798 D570A possibly damaging Het
Slco5a1 T A 1: 12,990,476 Q7L possibly damaging Het
Stt3b G T 9: 115,276,881 S175R probably damaging Het
Taar6 T A 10: 23,985,253 I132F probably benign Het
Tenm3 A G 8: 48,236,465 V2029A probably damaging Het
Tgm4 A G 9: 123,051,336 probably benign Het
Togaram1 T A 12: 64,966,984 C336* probably null Het
Ttn G A 2: 76,937,671 T3028M unknown Het
Vmn2r25 A T 6: 123,851,832 I161N possibly damaging Het
Vwf T C 6: 125,666,677 C2394R Het
Other mutations in Galnt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Galnt16 APN 12 80592490 splice site probably null
IGL02614:Galnt16 APN 12 80576563 missense probably damaging 0.99
PIT4504001:Galnt16 UTSW 12 80592417 nonsense probably null
R0032:Galnt16 UTSW 12 80592469 missense probably damaging 1.00
R1109:Galnt16 UTSW 12 80590631 missense probably benign
R1560:Galnt16 UTSW 12 80601792 missense possibly damaging 0.77
R1595:Galnt16 UTSW 12 80590636 missense probably damaging 0.99
R1991:Galnt16 UTSW 12 80583656 missense probably damaging 1.00
R2103:Galnt16 UTSW 12 80583656 missense probably damaging 1.00
R4866:Galnt16 UTSW 12 80584077 missense probably damaging 1.00
R4972:Galnt16 UTSW 12 80572329 nonsense probably null
R5140:Galnt16 UTSW 12 80581299 missense possibly damaging 0.94
R5228:Galnt16 UTSW 12 80584048 missense probably damaging 1.00
R5414:Galnt16 UTSW 12 80584048 missense probably damaging 1.00
R5592:Galnt16 UTSW 12 80588519 missense probably damaging 1.00
R6433:Galnt16 UTSW 12 80575903 missense probably benign 0.44
R6634:Galnt16 UTSW 12 80519170 start codon destroyed probably null 0.95
R7021:Galnt16 UTSW 12 80580052 missense probably damaging 0.99
R7534:Galnt16 UTSW 12 80597135 missense probably damaging 0.99
R7567:Galnt16 UTSW 12 80581310 critical splice donor site probably null
R7681:Galnt16 UTSW 12 80590639 missense probably damaging 1.00
R7983:Galnt16 UTSW 12 80601824 missense probably benign 0.00
Z1177:Galnt16 UTSW 12 80572347 missense probably benign 0.14
Z1177:Galnt16 UTSW 12 80601810 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTGCAGTGATCTAGTCCAG -3'
(R):5'- TGTGAAGCACTTACAACCCCAG -3'

Sequencing Primer
(F):5'- AGTCCAGACTAGAGTTTTCCAGG -3'
(R):5'- CTCATCTTCACCGAGGAAGGATTG -3'
Posted On2019-11-26