Incidental Mutation 'RF005:Kl'
ID602746
Institutional Source Beutler Lab
Gene Symbol Kl
Ensembl Gene ENSMUSG00000058488
Gene Nameklotho
Synonymsalpha-kl
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF005 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location150952607-150993817 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 150953420 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 235 (Y235S)
Ref Sequence ENSEMBL: ENSMUSP00000077899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078856]
Predicted Effect probably benign
Transcript: ENSMUST00000078856
AA Change: Y235S

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000077899
Gene: ENSMUSG00000058488
AA Change: Y235S

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 45 56 N/A INTRINSIC
Pfam:Glyco_hydro_1 59 380 4.3e-99 PFAM
Pfam:Glyco_hydro_1 376 508 7.9e-33 PFAM
Pfam:Glyco_hydro_1 517 955 1e-79 PFAM
transmembrane domain 984 1006 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency 94% (65/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I membrane protein that is related to beta-glucosidases. Reduced production of this protein has been observed in patients with chronic renal failure (CRF), and this may be one of the factors underlying the degenerative processes (e.g., arteriosclerosis, osteoporosis, and skin atrophy) seen in CRF. Also, mutations within this protein have been associated with ageing and bone loss. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have a short lifespan and growth retardation with one allele homeostatic imbalances and soft tissue calcification are also seen. With a second allele abnormal cancellous bone and femur morphology are seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AGAAAGGAAAAGGTGGCCAG AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,884 probably benign Het
A030005L19Rik CTGCTG CTGCTGTGGATGCTG 1: 82,913,585 probably benign Het
Abca1 G T 4: 53,049,125 T1651N probably damaging Het
Adamtsl3 A G 7: 82,612,395 T40A Het
Adgra3 A T 5: 50,013,387 probably null Het
Apcs A T 1: 172,894,242 M179K probably damaging Het
Baiap2 G A 11: 119,996,529 E217K possibly damaging Het
Ccdc69 A G 11: 55,060,523 L24P probably damaging Het
Cdh16 T G 8: 104,617,052 N604T probably damaging Het
Cfb C T 17: 34,858,046 V538I possibly damaging Het
Col6a3 A G 1: 90,811,262 S1022P probably benign Het
Cpeb1 A G 7: 81,361,806 L129S possibly damaging Het
Crybg1 A G 10: 44,004,745 V149A probably benign Het
Cyp4f16 C A 17: 32,545,195 probably null Het
Dlg5 G A 14: 24,158,493 Q882* probably null Het
Fsip2 T A 2: 82,992,532 I6203K probably benign Het
Gabre CCGGCT CCGGCTACGGCT X: 72,270,045 probably null Het
Gm17660 A C 5: 104,074,859 probably null Het
Gm9513 T C 9: 36,475,674 S13P possibly damaging Het
Gprc5d A T 6: 135,116,519 L130Q probably damaging Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Hmcn1 T A 1: 150,635,146 K3609* probably null Het
Hsdl2 GCTGCAG GCTGCAGCAGCAGCCACATCTGCAG 4: 59,610,652 probably benign Het
Map6d1 G A 16: 20,241,000 T105I probably benign Het
Mast4 GGTGGTGGTGG GGTGGTGGTGGTGGTGG 13: 102,736,307 probably benign Het
Mbd1 TGTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC TATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC 18: 74,273,573 probably benign Het
Mms22l A G 4: 24,517,207 I363V probably benign Het
Myo7a T C 7: 98,093,617 I391V probably benign Het
Nab2 A T 10: 127,664,364 D286E probably benign Het
Nrxn1 G A 17: 90,362,876 R1144C probably damaging Het
Olfr1039 T C 2: 86,131,070 M198V probably benign Het
Olfr592 T C 7: 103,186,691 I30T possibly damaging Het
Olfr635 A G 7: 103,979,561 D123G probably damaging Het
Pan2 G A 10: 128,315,535 E842K probably benign Het
Prex2 A C 1: 11,185,166 D1145A possibly damaging Het
Prop1 A C 11: 50,951,130 Y150D possibly damaging Het
Prp2 AGGCCCACAGCAGCGACCCCCTCAAGGCCCACCACCACCAGGTGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC AGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC 6: 132,600,501 probably benign Het
Psip1 T C 4: 83,460,498 I353M probably damaging Het
Rapgef1 C A 2: 29,707,195 probably null Het
Rgl1 G A 1: 152,521,363 S684L probably benign Het
Sbf2 T A 7: 110,317,008 D1552V probably damaging Het
Serpinh1 C T 7: 99,346,203 V391M probably damaging Het
Slc35e4 A T 11: 3,907,960 L215Q possibly damaging Het
Tbl3 TCTT TCTTCTT 17: 24,702,541 probably benign Het
Tex15 T A 8: 33,576,677 M2045K probably benign Het
Tmprss15 T C 16: 78,953,801 *1070W probably null Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,649,750 probably benign Het
Trav15-2-dv6-2 GGAG GGAGGAG 14: 53,649,751 probably benign Het
Trav15-2-dv6-2 GAA GAACAA 14: 53,649,754 probably benign Het
Trim33 GCCCCGGCCCCCG GCCCCG 3: 103,280,212 probably null Het
Triobp GACAA GACAACCCCAGGACTCCCTGTGCCCAACGGAACAA 15: 78,967,061 probably benign Het
Tub C A 7: 109,022,639 Q95K probably benign Het
Uhrf1bp1 A T 17: 27,885,531 D517V probably damaging Het
Usp9y T A Y: 1,435,046 Q261L probably benign Het
Utp20 A T 10: 88,825,457 D29E probably damaging Het
Vill G A 9: 119,060,439 V148M probably damaging Het
Vmn2r120 C T 17: 57,521,991 E535K possibly damaging Het
Zfp451 A T 1: 33,776,792 Y692* probably null Het
Zfp599 A C 9: 22,253,884 V65G probably benign Het
Zfp808 T C 13: 62,171,299 V114A probably benign Het
Znrd1as CACCACCACCACCACCACCAC CACCACCACCACCACCACCACAACCACCACCACCACCACCAC 17: 36,965,048 probably benign Het
Other mutations in Kl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00800:Kl APN 5 150980768 nonsense probably null
IGL00815:Kl APN 5 150980850 missense possibly damaging 0.55
IGL00840:Kl APN 5 150980787 missense possibly damaging 0.90
IGL01347:Kl APN 5 150980665 missense probably damaging 1.00
IGL01642:Kl APN 5 150980869 missense possibly damaging 0.58
IGL01774:Kl APN 5 150988483 missense probably benign 0.00
IGL01937:Kl APN 5 150988937 missense probably damaging 0.99
IGL01945:Kl APN 5 150988937 missense probably damaging 0.99
IGL02510:Kl APN 5 150989001 missense probably damaging 1.00
IGL02696:Kl APN 5 150980985 missense probably benign 0.01
IGL03028:Kl APN 5 150991550 missense probably damaging 1.00
IGL03149:Kl APN 5 150982735 nonsense probably null
anatolia UTSW 5 150988853 missense possibly damaging 0.69
ararat UTSW 5 150988853 missense possibly damaging 0.69
R0480:Kl UTSW 5 150953288 missense probably damaging 1.00
R0565:Kl UTSW 5 150980944 missense possibly damaging 0.76
R0723:Kl UTSW 5 150953101 missense probably damaging 1.00
R1052:Kl UTSW 5 150982520 missense probably damaging 1.00
R1205:Kl UTSW 5 150980688 missense probably damaging 1.00
R1512:Kl UTSW 5 150988597 missense probably benign 0.00
R1529:Kl UTSW 5 150988941 missense probably benign
R1588:Kl UTSW 5 150982632 missense probably benign 0.20
R1714:Kl UTSW 5 150953333 missense probably benign 0.05
R1748:Kl UTSW 5 150980985 missense possibly damaging 0.87
R1885:Kl UTSW 5 150953494 missense possibly damaging 0.67
R1920:Kl UTSW 5 150982667 missense probably benign 0.15
R2156:Kl UTSW 5 150988960 missense probably benign 0.41
R2926:Kl UTSW 5 150953341 missense probably damaging 1.00
R4837:Kl UTSW 5 150980847 missense possibly damaging 0.90
R5221:Kl UTSW 5 150989151 missense probably damaging 1.00
R5687:Kl UTSW 5 150988466 missense possibly damaging 0.84
R5726:Kl UTSW 5 150991538 missense possibly damaging 0.91
R5727:Kl UTSW 5 150991538 missense possibly damaging 0.91
R5735:Kl UTSW 5 150991538 missense possibly damaging 0.91
R5797:Kl UTSW 5 150991538 missense possibly damaging 0.91
R5933:Kl UTSW 5 150989483 missense probably damaging 1.00
R6075:Kl UTSW 5 150953001 missense probably damaging 1.00
R6076:Kl UTSW 5 150953001 missense probably damaging 1.00
R6077:Kl UTSW 5 150953001 missense probably damaging 1.00
R6149:Kl UTSW 5 150988853 missense possibly damaging 0.69
R6150:Kl UTSW 5 150988853 missense possibly damaging 0.69
R6151:Kl UTSW 5 150988853 missense possibly damaging 0.69
R6158:Kl UTSW 5 150988853 missense possibly damaging 0.69
R6236:Kl UTSW 5 150953290 missense probably damaging 1.00
R6609:Kl UTSW 5 150988962 missense probably benign 0.00
R7489:Kl UTSW 5 150952996 missense probably damaging 1.00
R8406:Kl UTSW 5 150982764 missense probably benign 0.01
RF024:Kl UTSW 5 150953420 missense probably benign 0.07
X0066:Kl UTSW 5 150991615 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTACAACAACGTCTACCGCG -3'
(R):5'- CCTGTGTGACCTCGTAATGG -3'

Sequencing Primer
(F):5'- TCTACCGCGACACAGAGG -3'
(R):5'- TGACCTCGTAATGGGTTCAAGTAAG -3'
Posted On2019-12-04